ModCRE DB

Transcription factor

Q86YE8 - ZNF573

Zinc finger protein 573

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 665 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1
MotifPredictionSourceDNA bindingSupportLogoActions
M07693_2.00 Known CisBP CTCCTGTGTGTGCCTTGGCTG Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 665 aa
159-437

Region 159-437 0 PWM

Residues
279 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5WJQ
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 159-4371 model
Actions
Predicted = Low TFS_Q86YE8:159:437_5wjq_D_1 5wjq 159-437 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
27-68PF01352KRAB boxNo overlap with loaded model regions
134-156PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
162-184PF00096Zinc finger, C2H2 typeoverlaps 159-437
190-212PF00096Zinc finger, C2H2 typeoverlaps 159-437
218-240PF00096Zinc finger, C2H2 typeoverlaps 159-437
246-268PF00096Zinc finger, C2H2 typeoverlaps 159-437
274-296PF00096Zinc finger, C2H2 typeoverlaps 159-437
302-324PF00096Zinc finger, C2H2 typeoverlaps 159-437
330-352PF00096Zinc finger, C2H2 typeoverlaps 159-437
358-380PF00096Zinc finger, C2H2 typeoverlaps 159-437
386-408PF00096Zinc finger, C2H2 typeoverlaps 159-437
414-436PF00096Zinc finger, C2H2 typeoverlaps 159-437
442-464PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
470-492PF13912C2H2-type zinc fingerNo overlap with loaded model regions
498-520PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
526-548PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
554-576PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
582-604PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
610-632PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
638-660PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions