Region 344-483 5 PWM
- Residues
- 140 aa
- Domains
- No overlapping PFAM annotation recorded
- 3D models
- 11 active PDBs · 6 summary rows
- Templates
- 1LLM, 5V3J, 5V3M, 5WJQ, 6E93, 6E94, 6ML3, 6ML4, ...
- Sources
- Predicted = Low
Transcription factor
Q86YH2 - ZNF280B
Zinc finger protein 280B (5'OY11.1) (Suppressor of hairy wing homolog 2) (Zinc finger protein 279) (Zinc finger protein 632)
Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 543 aa
Motif Prediction
Only entries with a generated matrix are shown here.
Known0
No generated PWM in this category.
Nearest Neighbor (>70%)0
No generated PWM in this category.
Nearest Neighbor (70% - 40%)1
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| M08332_2.00 | NN 70-40% | CisBP | TCTCTCCAGTGTGAATTCTCTGAT | 66.0% identity | Open · Scan |
ModCRE5
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| TFS_sp_Q86YH2_Z280B_HUMAN:345:480_5v3j_E_1 | ModCRE | Homology model | TTTTGTTTGGGGGTGT | Region 345-480 · 1 3D model | Open · Scan | |
| TFS_sp_Q86YH2_Z280B_HUMAN:345:480_5v3m_C_1 | ModCRE | Homology model | TTCCTGACTCTCGAAAT | Region 345-480 · 1 3D model | Open · Scan | |
| TFS_sp_Q86YH2_Z280B_HUMAN:345:480_5wjq_D_1 | ModCRE | Homology model | GGCCTGGGGGGCCGTT | Region 345-480 · 1 3D model | Open · Scan | |
| TFS_sp_Q86YH2_Z280B_HUMAN:375:479_6e93_A_1 | ModCRE | Homology model | CTCCCGCGCGGAATATTC | Region 375-479 · 1 3D model | Open · Scan | |
| TFS_sp_Q86YH2_Z280B_HUMAN:375:479_6e94_A_1 | ModCRE | Homology model | GACCGGCCCGGGGGATTC | Region 375-479 · 1 3D model | Open · Scan |
Model-supported DNA-binding regions
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
1
543 aa
344-483
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
11 active PDB models
6 summary rows
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
Region 344-48311 models · 6 summary rows
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | DIMER_sp_Q86YH2_Z280B_HUMAN:430:483_1llm_D_1 | 1llm | 430-483 | View model · PDB |
| Predicted = Low | TFS_sp_Q86YH2_Z280B_HUMAN:344:478_6ml4_A_1 | 6ml4 | 344-478 | View model · PDB |
| Predicted = Low | TFS_sp_Q86YH2_Z280B_HUMAN:344:478_6ml5_A_1 | 6ml5 | 344-478 | View model · PDB |
| Predicted = Low | TFS_sp_Q86YH2_Z280B_HUMAN:344:478_6ml6_A_1 | 6ml6 | 344-478 | View model · PDB |
| Predicted = Low | TFS_sp_Q86YH2_Z280B_HUMAN:344:478_6ml7_A_1 | 6ml7 | 344-478 | View model · PDB |
| Predicted = Low | TFS_sp_Q86YH2_Z280B_HUMAN:345:454_6ml3_A_1 | 6ml3 | 345-454 | View model · PDB |
| Predicted = Low | TFS_sp_Q86YH2_Z280B_HUMAN:345:480_5v3j_E_1 | 5v3j | 345-480 | View model · PDB |
| Predicted = Low | TFS_sp_Q86YH2_Z280B_HUMAN:345:480_5v3m_C_1 | 5v3m | 345-480 | View model · PDB |
| Predicted = Low | TFS_sp_Q86YH2_Z280B_HUMAN:345:480_5wjq_D_1 | 5wjq | 345-480 | View model · PDB |
| Predicted = Low | TFS_sp_Q86YH2_Z280B_HUMAN:375:479_6e93_A_1 | 6e93 | 375-479 | View model · PDB |
| Predicted = Low | TFS_sp_Q86YH2_Z280B_HUMAN:375:479_6e94_A_1 | 6e94 | 375-479 | View model · PDB |
Model-summary evidence imported for this region.
| Rank | Template | Domain | N-tails | C-tails | Chains | Identity / similarity | Coverage | Model file |
|---|---|---|---|---|---|---|---|---|
| 1 | 6ml3 | 332:483 | 345 | 454 | P:A · DNA:E,F | 34.8% / 44.6% | 91 | View · PDB TFS_sp_Q86YH2_Z280B_HUMAN:345:454_6ml3_A_1 |
| 2 | 6ml7 | 332:483 | 344 | 478 | P:A · DNA:E,F | 29.6% / 40.7% | 90 | View · PDB TFS_sp_Q86YH2_Z280B_HUMAN:344:478_6ml7_A_1 |
| 3 | 6ml6 | 332:483 | 344 | 478 | P:A · DNA:E,F | 29.6% / 40.7% | 90 | View · PDB TFS_sp_Q86YH2_Z280B_HUMAN:344:478_6ml6_A_1 |
| 4 | 6ml4 | 332:483 | 344 | 478 | P:A · DNA:E,F | 29.6% / 40.7% | 90 | View · PDB TFS_sp_Q86YH2_Z280B_HUMAN:344:478_6ml4_A_1 |
| 5 | 6ml5 | 332:483 | 344 | 478 | P:A · DNA:E,F | 29.6% / 40.7% | 91 | View · PDB TFS_sp_Q86YH2_Z280B_HUMAN:344:478_6ml5_A_1 |
| 1 | 1llm | 332:483 | 430,430 | 483,483 | P:C,D · DNA:A,B | 25.9% / 38.9% | 62,63 | View · PDB DIMER_sp_Q86YH2_Z280B_HUMAN:430:483_1llm_D_1 |
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Domains
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 45-226 | PF13836 | Domain of unknown function (DUF4195) | No overlap with loaded model regions |