Transcription factor

Q8IW09 - ZNF335

Zinc finger protein 335 (NRC-interacting factor 1)

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 1121 aa

8 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)3

Motif	Prediction	Source	DNA binding	Support	Actions
M01181_2.00	NN 70-40%	CisBP	GCGCATCCCC	55.0% identity	Open · Scan
M01199_2.00	NN 70-40%	CisBP	GCGCCACC	53.8% identity	Open · Scan
M06135_2.00	NN 70-40%	CisBP	CAGCCACGCCCACCT	50.0% identity	Open · Scan

ModCRE5

Motif	Prediction	Source	DNA binding	Support	Actions
DIMER_tr_Q8IW09_Q8IW09_HUMAN:851:900_1llm_D_1	ModCRE	Homology model	CCCGCGCGCGGG	Region 851-900 · 1 3D model	Open · Scan
TFS_tr_Q8IW09_Q8IW09_HUMAN:242:477_5wjq_D_1	ModCRE	Homology model	GGGCAAGGGGGCGTGGCCGGGGGG	Region 242-477 · 1 3D model	Open · Scan
TFS_tr_Q8IW09_Q8IW09_HUMAN:242:484_8ssu_A_1	ModCRE	Homology model	GATCCCCAGTGTCTTGCCC	Region 242-484 · 1 3D model	Open · Scan
TFS_tr_Q8IW09_Q8IW09_HUMAN:275:477_5v3j_E_1	ModCRE	Homology model	CCGGGGAAACTTTTGCTG	Region 275-477 · 1 3D model	Open · Scan
TFS_tr_Q8IW09_Q8IW09_HUMAN:275:477_5v3m_C_1	ModCRE	Homology model	GCAGGGTATTCATTTATAT	Region 275-477 · 1 3D model	Open · Scan

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 1121 aa

242-484

851-900

Scan this region Show models

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

6 active PDB models 6 summary rows

Region 242-4845 models · 5 summary rows

Model-summary evidence imported for this region.

Rank	Template	Domain	N-tails	C-tails	Chains	Identity / similarity	Coverage	Model file
2	5v3m	242:484	275	477	P:C · DNA:A,B	35.5% / 45.3%	67	View · PDB TFS_tr_Q8IW09_Q8IW09_HUMAN:275:477_5v3m_C_1
3	5v3j	242:484	275	477	P:E · DNA:A,B	35.5% / 45.3%	67	View · PDB TFS_tr_Q8IW09_Q8IW09_HUMAN:275:477_5v3j_E_1
4	5wjq	242:484	242	477	P:D · DNA:A,B	30.9% / 40.7%	78	View · PDB TFS_tr_Q8IW09_Q8IW09_HUMAN:242:477_5wjq_D_1
1	7w1m	242:484	242	484	P:H · DNA:F,G	28.2% / 44.5%	71	View · PDB TFS_tr_Q8IW09_Q8IW09_HUMAN:242:484_7w1m_H_1
5	8ssu	242:484	242	484	P:A · DNA:B,C	28.2% / 44.5%	98	View · PDB TFS_tr_Q8IW09_Q8IW09_HUMAN:242:484_8ssu_A_1

Region 851-9001 model · 1 summary row

				Actions
Predicted = Low	DIMER_tr_Q8IW09_Q8IW09_HUMAN:851:900_1llm_D_1	1llm	851-900	View model · PDB

Model-summary evidence imported for this region.

Rank	Template	Domain	N-tails	C-tails	Chains	Identity / similarity	Coverage	Model file
1	1llm	242:484	851,851	900,900	P:C,D · DNA:A,B	42.0% / 56.0%	57,58	View · PDB DIMER_tr_Q8IW09_Q8IW09_HUMAN:851:900_1llm_D_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
341-364	PF13912	C2H2-type zinc finger	overlaps 242-484
369-391	PF00096	Zinc finger, C2H2 type	overlaps 242-484
855-878	PF13909	C2H2-type zinc-finger domain	overlaps 851-900