ModCRE DB

Transcription factor

Q8IWY8 - ZSCAN29

Zinc finger and SCAN domain-containing protein 29 (Zinc finger protein 690)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 852 aa

6 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known6
MotifPredictionSourceDNA bindingSupportLogoActions
MA1602.1 Known JASPAR CGTCTACACGGG Direct PWM Open · Scan
MA1602.2 Known JASPAR CGTCTACACGG Direct PWM Open · Scan
M01165_2.00 Known CisBP AAATCCGGAT Direct PWM Open · Scan
M04384_2.00 Known CisBP CCGCGTAGACGTCTACACAG Direct PWM Open · Scan
M04385_2.00 Known CisBP CCGTGTAGACGTCTACACAG Direct PWM Open · Scan
M08271_2.00 Known CisBP CGTCTACACGGG Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 852 aa
636-840

Region 636-840 0 PWM

Residues
205 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5V3J
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 636-8401 model
Actions
Predicted = Low TFS_Q8IWY8:636:840_5v3j_E_1 5v3j 636-840 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
14-102PF02023SCAN domainNo overlap with loaded model regions
247-330PF13837Myb/SANT-like DNA-binding domainNo overlap with loaded model regions
410-493PF13837Myb/SANT-like DNA-binding domainNo overlap with loaded model regions
678-700PF00096Zinc finger, C2H2 typeoverlaps 636-840
706-728PF00096Zinc finger, C2H2 typeoverlaps 636-840
734-756PF00096Zinc finger, C2H2 typeoverlaps 636-840
762-784PF00096Zinc finger, C2H2 typeoverlaps 636-840
790-812PF00096Zinc finger, C2H2 typeoverlaps 636-840
820-840PF00096Zinc finger, C2H2 typeoverlaps 636-840