ModCRE DB

Transcription factor

Q8N1W2 - ZNF710

Zinc finger protein 710

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 664 aa

8 Generated PWM 9 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M08908_2.00 NN 70-40% CisBP GCTGCTGCTTCTGCTG 50.0% identity Open · Scan
ModCRE7
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_sp_Q8N1W2_ZN710_HUMAN:321:429_5egb_A_1 ModCRE Homology model CGGGGGCCAGGGGGGGGG Region 321-429 · 1 3D model Open · Scan
TFS_sp_Q8N1W2_ZN710_HUMAN:321:429_5ei9_E_1 ModCRE Homology model CCGGGGCCCGGGGGCCG Region 321-429 · 1 3D model Open · Scan
TFS_sp_Q8N1W2_ZN710_HUMAN:321:596_5wjq_D_1 ModCRE Homology model CCCGGGGGGGGCGGGGTTTGGGGCCGCC Region 321-596 · 1 3D model Open · Scan
TFS_sp_Q8N1W2_ZN710_HUMAN:322:596_5v3j_E_1 ModCRE Homology model CGGAGAGGGTAAAGGGGGCCCCTGC Region 322-596 · 1 3D model Open · Scan
TFS_sp_Q8N1W2_ZN710_HUMAN:322:596_5v3m_C_1 ModCRE Homology model CCTTAGGGGATGGTTTAACCGGGGTG Region 322-596 · 1 3D model Open · Scan
TFS_sp_Q8N1W2_ZN710_HUMAN:407:566_5t0u_A_1 ModCRE Homology model GCGGGCAGGGGCGCCGGCGTTTT Region 407-566 · 1 3D model Open · Scan
TFS_sp_Q8N1W2_ZN710_HUMAN:444:595_2i13_A_1 ModCRE Homology model GCGACTAGCCAGCTTTAAATT Region 444-595 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 664 aa
295-598

Region 295-598 7 PWM

Residues
304 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF13912 · C2H2-type zinc finger PF00096 · Zinc finger, C2H2 type
3D models
9 active PDBs · 6 summary rows
Templates
1LLM, 2I13, 5EGB, 5EI9, 5T0U, 5V3J, 5V3M, 5WJQ, ...
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
9 active PDB models 6 summary rows
Region 295-5989 models · 6 summary rows
Actions
Predicted = Low DIMER_sp_Q8N1W2_ZN710_HUMAN:544:598_1llm_C_1 1llm 544-598 View model · PDB
Predicted = Low TFS_sp_Q8N1W2_ZN710_HUMAN:295:593_7w1m_H_1 7w1m 295-593 View model · PDB
Predicted = Low TFS_sp_Q8N1W2_ZN710_HUMAN:321:429_5egb_A_1 5egb 321-429 View model · PDB
Predicted = Low TFS_sp_Q8N1W2_ZN710_HUMAN:321:429_5ei9_E_1 5ei9 321-429 View model · PDB
Predicted = Low TFS_sp_Q8N1W2_ZN710_HUMAN:321:596_5wjq_D_1 5wjq 321-596 View model · PDB
Predicted = Low TFS_sp_Q8N1W2_ZN710_HUMAN:322:596_5v3j_E_1 5v3j 322-596 View model · PDB
Predicted = Low TFS_sp_Q8N1W2_ZN710_HUMAN:322:596_5v3m_C_1 5v3m 322-596 View model · PDB
Predicted = Low TFS_sp_Q8N1W2_ZN710_HUMAN:407:566_5t0u_A_1 5t0u 407-566 View model · PDB
Predicted = Low TFS_sp_Q8N1W2_ZN710_HUMAN:444:595_2i13_A_1 2i13 444-595 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
4 2i13 295:598 444 595 P:A · DNA:C,D 40.1% / 53.3% 98 View · PDB TFS_sp_Q8N1W2_ZN710_HUMAN:444:595_2i13_A_1
1 5v3m 295:598 322 596 P:C · DNA:A,B 38.9% / 51.3% 99 View · PDB TFS_sp_Q8N1W2_ZN710_HUMAN:322:596_5v3m_C_1
2 5v3j 295:598 322 596 P:E · DNA:A,B 38.9% / 51.3% 99 View · PDB TFS_sp_Q8N1W2_ZN710_HUMAN:322:596_5v3j_E_1
1 1llm 295:598 544,544 598,598 P:C,D · DNA:A,B 38.2% / 58.2% 63,64 View · PDB DIMER_sp_Q8N1W2_ZN710_HUMAN:544:598_1llm_C_1
3 5wjq 295:598 321 596 P:D · DNA:A,B 36.6% / 51.4% 98 View · PDB TFS_sp_Q8N1W2_ZN710_HUMAN:321:596_5wjq_D_1
5 7w1m 295:598 295 593 P:H · DNA:F,G 29.2% / 43.8% 92 View · PDB TFS_sp_Q8N1W2_ZN710_HUMAN:295:593_7w1m_H_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
296-317PF00096Zinc finger, C2H2 typeoverlaps 295-598
323-345PF00096Zinc finger, C2H2 typeoverlaps 295-598
351-373PF00096Zinc finger, C2H2 typeoverlaps 295-598
379-401PF00096Zinc finger, C2H2 typeoverlaps 295-598
407-429PF00096Zinc finger, C2H2 typeoverlaps 295-598
435-457PF00096Zinc finger, C2H2 typeoverlaps 295-598
463-485PF00096Zinc finger, C2H2 typeoverlaps 295-598
491-513PF00096Zinc finger, C2H2 typeoverlaps 295-598
519-541PF00096Zinc finger, C2H2 typeoverlaps 295-598
547-566PF13912C2H2-type zinc fingeroverlaps 295-598
575-598PF00096Zinc finger, C2H2 typeoverlaps 295-598