ModCRE DB

Transcription factor

Q8N393 - ZNF786

Zinc finger protein 786

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 782 aa

13 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1
MotifPredictionSourceDNA bindingSupportLogoActions
M07721_2.00 Known CisBP CTGGGGC Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)8
MotifPredictionSourceDNA bindingSupportLogoActions
M00959_2.00 NN 70-40% CisBP GCCCTCCC 56.6% identity Open · Scan
M00960_2.00 NN 70-40% CisBP TGCATCCC 56.6% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 54.2% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 54.1% identity Open · Scan
M00950_2.00 NN 70-40% CisBP GCAGCCCA 50.5% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 50.0% identity Open · Scan
M04387_2.00 NN 70-40% CisBP CGTGCTCCCC 50.0% identity Open · Scan
M06179_2.00 NN 70-40% CisBP TAAGCCTATAGA 50.0% identity Open · Scan
ModCRE4
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_sp_Q8N393_ZN786_HUMAN:424:699_5v3j_E_1 ModCRE Homology model GCTGCCCTGGTGCCGGGGCCCCCCGA Region 424-699 · 1 3D model Open · Scan
TFS_sp_Q8N393_ZN786_HUMAN:424:699_5v3m_C_1 ModCRE Homology model TGGGGGGGGCGGGGCGGGGGGGGGGG Region 424-699 · 1 3D model Open · Scan
TFS_sp_Q8N393_ZN786_HUMAN:450:726_5wjq_D_1 ModCRE Homology model GACGGGGGGGGAGGGGGGGTGCCGTAGG Region 450-726 · 1 3D model Open · Scan
TFS_sp_Q8N393_ZN786_HUMAN:574:726_2i13_A_1 ModCRE Homology model TTAGGGTGCCCGGGCGTAAAT Region 574-726 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 782 aa
423-750

Region 423-750 4 PWM

Residues
328 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
6 active PDBs · 6 summary rows
Templates
1LLM, 2I13, 5V3J, 5V3M, 5WJQ, 7W1M
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models 6 summary rows
Region 423-7506 models · 6 summary rows
Actions
Predicted = Low DIMER_sp_Q8N393_ZN786_HUMAN:423:472_1llm_D_1 1llm 423-472 View model · PDB
Predicted = Low TFS_sp_Q8N393_ZN786_HUMAN:424:699_5v3j_E_1 5v3j 424-699 View model · PDB
Predicted = Low TFS_sp_Q8N393_ZN786_HUMAN:424:699_5v3m_C_1 5v3m 424-699 View model · PDB
Predicted = Low TFS_sp_Q8N393_ZN786_HUMAN:450:726_5wjq_D_1 5wjq 450-726 View model · PDB
Predicted = Low TFS_sp_Q8N393_ZN786_HUMAN:453:750_7w1m_H_1 7w1m 453-750 View model · PDB
Predicted = Low TFS_sp_Q8N393_ZN786_HUMAN:574:726_2i13_A_1 2i13 574-726 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
5 2i13 394:752 574 726 P:A · DNA:C,D 50.6% / 68.2% 99 View · PDB TFS_sp_Q8N393_ZN786_HUMAN:574:726_2i13_A_1
1 1llm 394:752 423,423 472,472 P:C,D · DNA:A,B 48.0% / 64.0% 57,58 View · PDB DIMER_sp_Q8N393_ZN786_HUMAN:423:472_1llm_D_1
1 5wjq 394:752 450 726 P:D · DNA:A,B 44.2% / 62.6% 98 View · PDB TFS_sp_Q8N393_ZN786_HUMAN:450:726_5wjq_D_1
2 5v3m 394:752 424 699 P:C · DNA:A,B 43.7% / 62.5% 99 View · PDB TFS_sp_Q8N393_ZN786_HUMAN:424:699_5v3m_C_1
3 5v3j 394:752 424 699 P:E · DNA:A,B 43.7% / 62.5% 99 View · PDB TFS_sp_Q8N393_ZN786_HUMAN:424:699_5v3j_E_1
4 7w1m 394:752 453 750 P:H · DNA:F,G 36.0% / 50.6% 92 View · PDB TFS_sp_Q8N393_ZN786_HUMAN:453:750_7w1m_H_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
8-49PF01352KRAB boxNo overlap with loaded model regions
240-262PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
425-447PF00096Zinc finger, C2H2 typeoverlaps 423-750
453-475PF00096Zinc finger, C2H2 typeoverlaps 423-750
481-503PF00096Zinc finger, C2H2 typeoverlaps 423-750
509-531PF00096Zinc finger, C2H2 typeoverlaps 423-750
565-587PF00096Zinc finger, C2H2 typeoverlaps 423-750
593-615PF00096Zinc finger, C2H2 typeoverlaps 423-750
621-643PF00096Zinc finger, C2H2 typeoverlaps 423-750
676-698PF00096Zinc finger, C2H2 typeoverlaps 423-750
704-726PF00096Zinc finger, C2H2 typeoverlaps 423-750
732-754PF00096Zinc finger, C2H2 typeoverlaps 423-750