ModCRE DB

Transcription factor

Q8N3X6 - LCORL

Ligand-dependent nuclear receptor corepressor-like protein (LCoR-like protein)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 602 aa

9 Generated PWM 4 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1
MotifPredictionSourceDNA bindingSupportLogoActions
M01304_2.00 Known CisBP CCAAAATT Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)4
MotifPredictionSourceDNA bindingSupportLogoActions
M06443_2.00 NN 70-40% CisBP ACACCCGAAAAT 62.0% identity Open · Scan
M02434_2.00 NN 70-40% CisBP CCCAAAAT 58.9% identity Open · Scan
M00707_2.00 NN 70-40% CisBP GGGGGGCCAA 56.6% identity Open · Scan
M02439_2.00 NN 70-40% CisBP GCCGAAATTT 50.0% identity Open · Scan
ModCRE4
MotifPredictionSourceDNA bindingSupportLogoActions
DIMER_sp_Q8N3X6_LCORL_HUMAN:96:126_4ldx_B_1 ModCRE Homology model GGGAACAGCCAGGTTGGTCCC Region 96-126 · 1 3D model Open · Scan
DIMER_sp_Q8N3X6_LCORL_HUMAN:96:126_6ycq_A_1 ModCRE Homology model GGCCCCAAGCAGATTGGTCCC Region 96-126 · 1 3D model Open · Scan
TFS_sp_Q8N3X6_LCORL_HUMAN:96:126_4ldx_B_1 ModCRE Homology model GGGACCAGACAGGATGTTCCC Region 96-126 · 1 3D model Open · Scan
TFS_sp_Q8N3X6_LCORL_HUMAN:96:126_6ycq_A_1 ModCRE Homology model GGGACCAAGCAGCTTGGGGCC Region 96-126 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 602 aa
96-126

Region 96-126 4 PWM

Residues
31 aa
Domains
No overlapping PFAM annotation recorded
3D models
4 active PDBs · 4 summary rows
Templates
4LDX, 6YCQ
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
4 active PDB models 4 summary rows
Region 96-1264 models · 4 summary rows
Actions
Predicted = Low DIMER_sp_Q8N3X6_LCORL_HUMAN:96:126_4ldx_B_1 4ldx 96-126 View model · PDB
Predicted = Low DIMER_sp_Q8N3X6_LCORL_HUMAN:96:126_6ycq_A_1 6ycq 96-126 View model · PDB
Predicted = Low TFS_sp_Q8N3X6_LCORL_HUMAN:96:126_4ldx_B_1 4ldx 96-126 View model · PDB
Predicted = Low TFS_sp_Q8N3X6_LCORL_HUMAN:96:126_6ycq_A_1 6ycq 96-126 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 6ycq 96:126 96,96 126,126 P:A,B · DNA:C,D 38.7% / 54.8% 8,9 View · PDB DIMER_sp_Q8N3X6_LCORL_HUMAN:96:126_6ycq_A_1
1 6ycq 96:126 96,96 126,126 P:A,B · DNA:C,D 38.7% / 54.8% 8,9 View · PDB TFS_sp_Q8N3X6_LCORL_HUMAN:96:126_6ycq_A_1
2 4ldx 96:126 96,96 126,126 P:A,B · DNA:C,D 38.7% / 54.8% 9,9 View · PIR DIMER_sp_Q8N3X6_LCORL_HUMAN:96:126_4ldx_B_1
2 4ldx 96:126 96,96 126,126 P:A,B · DNA:C,D 38.7% / 54.8% 9,9 View · PDB TFS_sp_Q8N3X6_LCORL_HUMAN:96:126_4ldx_B_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
280-311PF05225helix-turn-helix, Psq domainNo overlap with loaded model regions
526-570PF05225helix-turn-helix, Psq domainNo overlap with loaded model regions