ModCRE DB

Transcription factor

Q8N4S8

Similar to estrogen-related receptor alpha

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 299 aa

17 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)2
MotifPredictionSourceDNA bindingSupportLogoActions
MA0592.1 NN 70+% JASPAR CCAAGGTCACA 99.6% identity Open · Scan
MA0592.2 NN 70+% JASPAR TTCAAGGTCAT 98.6% identity Open · Scan
Nearest Neighbor (70% - 40%)15
MotifPredictionSourceDNA bindingSupportLogoActions
M09283_2.00 NN 70-40% CisBP TGAGGTCAAAAAAGTTCAG 65.0% identity Open · Scan
MA1533.1 NN 70-40% JASPAR ATGAACTCGATGAACTC 65.0% identity Open · Scan
MA0141.3 NN 70-40% JASPAR TCAAGGTCATA 62.3% identity Open · Scan
M08226_2.00 NN 70-40% CisBP CAAGGTCA 61.7% identity Open · Scan
M09296_2.00 NN 70-40% CisBP TCAAGGTCA 61.3% identity Open · Scan
MA0643.1 NN 70-40% JASPAR TCAAGGTCAT 61.3% identity Open · Scan
MA0141.1 NN 70-40% JASPAR AGCTCAAGGTCA 60.3% identity Open · Scan
M03928_2.00 NN 70-40% CisBP ATGTAGGTCAAG 51.8% identity Open · Scan
M11139_2.00 NN 70-40% CisBP AAGTAGGTCACCGTGACCTACTT 51.8% identity Open · Scan
MA0065.1 NN 70-40% JASPAR CCAGGGGTCAAAGGTCATCG 51.8% identity Open · Scan
MA0065.2 NN 70-40% JASPAR GTAGGGCAAAGGTCA 51.8% identity Open · Scan
M02411_2.00 NN 70-40% CisBP AGGACATC 51.7% identity Open · Scan
M00686_2.00 NN 70-40% CisBP AGTGATCA 51.5% identity Open · Scan
M00689_2.00 NN 70-40% CisBP AAAGATCAA 51.5% identity Open · Scan
M02413_2.00 NN 70-40% CisBP CGAGATCAA 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 299 aa
2-31

Region 2-31 0 PWM

Residues
30 aa
Domains
PF00105 · Double treble clef zinc finger, C4 type
3D models
1 active PDB
Templates
1DSZ
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 2-311 model
Actions
Predicted = Low DIMER_Q8N4S8:2:31_1dsz_B_1 1dsz 2-31 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
3-22PF00105Double treble clef zinc finger, C4 typeoverlaps 2-31
102-271PF00104Ligand-binding domain of nuclear hormone receptorNo overlap with loaded model regions