Region 256-366 0 PWM
- Residues
- 111 aa
- Domains
- PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
- 3D models
- 1 active PDB
- Templates
- 5EGB
- Sources
- Structure model
Transcription factor
Q8N4W9 - ZNF808
Zinc finger protein 808
Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 903 aa
Motif Prediction
Only entries with a generated matrix are shown here.
Known1
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| M07747_2.00 | Known | CisBP | TGGTCTATAAAGGGCCTGGTT | Direct PWM | Open · Scan |
Nearest Neighbor (>70%)0
No generated PWM in this category.
Nearest Neighbor (70% - 40%)0
No generated PWM in this category.
ModCRE0
No generated PWM in this category.
Model-supported DNA-binding regions
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
1
903 aa
256-366
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
Region 256-3661 model
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | TFS_Q8N4W9:256:366_5egb_A_1 | 5egb | 256-366 | View model · PDB |
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Domains
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 24-63 | PF01352 | KRAB box | No overlap with loaded model regions |
| 287-309 | PF00096 | Zinc finger, C2H2 type | overlaps 256-366 |
| 315-337 | PF00096 | Zinc finger, C2H2 type | overlaps 256-366 |
| 343-365 | PF00096 | Zinc finger, C2H2 type | overlaps 256-366 |
| 399-421 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 427-449 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 455-477 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 511-533 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 539-561 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 567-589 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 595-617 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 623-645 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 651-673 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 707-729 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 763-785 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 791-813 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 819-841 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 847-869 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 875-897 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |