ModCRE DB

Transcription factor

Q8N718 - ZKSCAN5

Zinc finger protein with KRAB and SCAN domains 5 (Zinc finger protein 95 homolog)

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 839 aa

21 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)2
MotifPredictionSourceDNA bindingSupportLogoActions
MA1652.1 NN 70+% JASPAR GGAGGAGGTGAGAA 99.8% identity Open · Scan
M00785_2.00 NN 70+% CisBP TTCACTTCCT 79.7% identity Open · Scan
Nearest Neighbor (70% - 40%)19
MotifPredictionSourceDNA bindingSupportLogoActions
M00959_2.00 NN 70-40% CisBP GCCCTCCC 63.5% identity Open · Scan
M00955_2.00 NN 70-40% CisBP ACGTCCTCT 62.3% identity Open · Scan
M00960_2.00 NN 70-40% CisBP TGCATCCC 62.3% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 61.1% identity Open · Scan
M00948_2.00 NN 70-40% CisBP GCAGCACC 60.0% identity Open · Scan
M00950_2.00 NN 70-40% CisBP GCAGCCCA 60.0% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 60.0% identity Open · Scan
M00953_2.00 NN 70-40% CisBP ATCTATAT 60.0% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 58.8% identity Open · Scan
M00958_2.00 NN 70-40% CisBP CGGCATCCC 57.6% identity Open · Scan
M04475_2.00 NN 70-40% CisBP GATGCACGTACCGTGCCTCA 57.2% identity Open · Scan
M08325_2.00 NN 70-40% CisBP TTTTTTTTT 56.2% identity Open · Scan
M04387_2.00 NN 70-40% CisBP CGTGCTCCCC 53.7% identity Open · Scan
M04598_2.00 NN 70-40% CisBP CGCTAACTCTCCACA 51.7% identity Open · Scan
M08295_2.00 NN 70-40% CisBP CTGCTGGAATCTCCA 51.6% identity Open · Scan
MA1154.1 NN 70-40% JASPAR CTTTCCCACAACACGAC 51.2% identity Open · Scan
M00019_2.00 NN 70-40% CisBP ACCCCTAATT 50.0% identity Open · Scan
M01531_2.00 NN 70-40% CisBP CCCCCCCTAAAT 50.0% identity Open · Scan
M06179_2.00 NN 70-40% CisBP TAAGCCTATAGA 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 839 aa
539-652

Region 539-652 0 PWM

Residues
114 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5T0U
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 539-6521 model
Actions
Predicted = Low TFS_Q8N718:539:652_5t0u_A_1 5t0u 539-652 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
47-134PF02023SCAN domainNo overlap with loaded model regions
222-258PF01352KRAB boxNo overlap with loaded model regions
346-368PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
374-396PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
402-424PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
432-452PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
549-571PF00096Zinc finger, C2H2 typeoverlaps 539-652
577-599PF00096Zinc finger, C2H2 typeoverlaps 539-652
605-627PF00096Zinc finger, C2H2 typeoverlaps 539-652
633-655PF00096Zinc finger, C2H2 typeoverlaps 539-652
717-739PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
773-795PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions