ModCRE DB

Transcription factor

Q8N720 - ZNF655

Zinc finger protein 655 (Vav-interacting Krueppel-like protein)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 491 aa

19 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known2
MotifPredictionSourceDNA bindingSupportLogoActions
M00251_2.00 Known CisBP AATGCTAAC Direct PWM Open · Scan
M00252_2.00 Known CisBP AATGCTAACT Direct PWM Open · Scan
Nearest Neighbor (>70%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M00250_2.00 NN 70+% CisBP AATGCTAACT 93.3% identity Open · Scan
Nearest Neighbor (70% - 40%)16
MotifPredictionSourceDNA bindingSupportLogoActions
M01181_2.00 NN 70-40% CisBP GCGCATCCCC 57.1% identity Open · Scan
M00960_2.00 NN 70-40% CisBP TGCATCCC 56.6% identity Open · Scan
M04653_2.00 NN 70-40% CisBP GGTACGGTTGTCCATGTTGCAA 55.5% identity Open · Scan
M04611_2.00 NN 70-40% CisBP CTTTCGGACAC 55.3% identity Open · Scan
MA0073.1 NN 70-40% JASPAR CCCCAAACCACCCCCCCCCA 55.1% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 53.0% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 51.8% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 51.8% identity Open · Scan
M00953_2.00 NN 70-40% CisBP ATCTATAT 51.8% identity Open · Scan
M00645_2.00 NN 70-40% CisBP CGCCCACGCA 50.8% identity Open · Scan
MA0095.1 NN 70-40% JASPAR GCCATC 50.8% identity Open · Scan
MA0748.1 NN 70-40% JASPAR GTCCGCCATTA 50.8% identity Open · Scan
M00939_2.00 NN 70-40% CisBP CCACCTCA 50.6% identity Open · Scan
M00955_2.00 NN 70-40% CisBP ACGTCCTCT 50.6% identity Open · Scan
M00959_2.00 NN 70-40% CisBP GCCCTCCC 50.6% identity Open · Scan
M01442_2.00 NN 70-40% CisBP ACCCCACATT 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 491 aa
188-459

Region 188-459 0 PWM

Residues
272 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5V3J
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 188-4591 model
Actions
Predicted = Low TFS_Q8N720:188:459_5v3j_E_1 5v3j 188-459 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
212-234PF00096Zinc finger, C2H2 typeoverlaps 188-459
240-262PF00096Zinc finger, C2H2 typeoverlaps 188-459
303-325PF00096Zinc finger, C2H2 typeoverlaps 188-459
380-402PF00096Zinc finger, C2H2 typeoverlaps 188-459
408-430PF00096Zinc finger, C2H2 typeoverlaps 188-459