ModCRE DB

Transcription factor

Q8N883 - ZNF614

Zinc finger protein 614

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 585 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1
MotifPredictionSourceDNA bindingSupportLogoActions
M07593_2.00 Known CisBP AGATGAAGTCACCCCTCTTAC Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 585 aa
274-421

Region 274-421 0 PWM

Residues
148 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
2I13
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 274-4211 model
Actions
Predicted = Low TFS_Q8N883:274:421_2i13_A_1 2i13 274-421 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
7-48PF01352KRAB boxNo overlap with loaded model regions
287-309PF00096Zinc finger, C2H2 typeoverlaps 274-421
315-337PF00096Zinc finger, C2H2 typeoverlaps 274-421
343-365PF00096Zinc finger, C2H2 typeoverlaps 274-421
371-393PF00096Zinc finger, C2H2 typeoverlaps 274-421
399-421PF00096Zinc finger, C2H2 typeoverlaps 274-421
427-449PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
455-475PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
483-505PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
511-533PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
541-561PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions