ModCRE DB

Transcription factor

Q8N883 - ZNF614

Zinc finger protein 614

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 585 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1
MotifPredictionSourceDNA bindingSupportLogoActions
M07593_2.00 Known CisBP AGATGAAGTCACCCCTCTTAC Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 585 aa
274-421

Region 274-421 0 PWM

Residues
148 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
2I13
Sources
Structure model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 274-4211 model
Actions
Predicted = Low TFS_Q8N883:274:421_2i13_A_1 2i13 274-421 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
7-48PF01352KRAB boxNo overlap with loaded model regions
287-309PF00096Zinc finger, C2H2 typeoverlaps 274-421
315-337PF00096Zinc finger, C2H2 typeoverlaps 274-421
343-365PF00096Zinc finger, C2H2 typeoverlaps 274-421
371-393PF00096Zinc finger, C2H2 typeoverlaps 274-421
399-421PF00096Zinc finger, C2H2 typeoverlaps 274-421
427-449PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
455-475PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
483-505PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
511-533PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
541-561PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions