ModCRE DB

Transcription factor

Q8N895 - ZNF366

Zinc finger protein 366 (Dendritic cell-specific transcript protein) (DC-SCRIPT)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 744 aa

9 Generated PWM 8 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)2
MotifPredictionSourceDNA bindingSupportLogoActions
M00224_2.00 NN 70-40% CisBP CCCGCCCC 50.0% identity Open · Scan
M09008_2.00 NN 70-40% CisBP CCCGGCCCCACCCT 50.0% identity Open · Scan
ModCRE7
MotifPredictionSourceDNA bindingSupportLogoActions
DIMER_sp_Q8N895_ZN366_HUMAN:502:556_1llm_C_1 ModCRE Homology model CCCGCGCGCGGG Region 502-556 · 1 3D model Open · Scan
TFS_sp_Q8N895_ZN366_HUMAN:279:387_5egb_A_1 ModCRE Homology model CCGAAAGGGGGGGCCGGG Region 279-387 · 1 3D model Open · Scan
TFS_sp_Q8N895_ZN366_HUMAN:279:387_5ei9_E_1 ModCRE Homology model CGGGGGCGAGGGGGGCG Region 279-387 · 1 3D model Open · Scan
TFS_sp_Q8N895_ZN366_HUMAN:279:554_5wjq_D_1 ModCRE Homology model CCCAGGGGCTGCATAGTTTGCAGGGCCC Region 279-554 · 1 3D model Open · Scan
TFS_sp_Q8N895_ZN366_HUMAN:280:554_5v3j_E_1 ModCRE Homology model TCTGGAGGGGAAAAACCGGGGGCTCC Region 280-554 · 1 3D model Open · Scan
TFS_sp_Q8N895_ZN366_HUMAN:280:554_5v3m_C_1 ModCRE Homology model ATGTGACAGTTGGTGCACATGGGCCG Region 280-554 · 1 3D model Open · Scan
TFS_sp_Q8N895_ZN366_HUMAN:290:443_2i13_A_1 ModCRE Homology model AATTTTAGGCTTCAGCATTGA Region 290-443 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 744 aa
253-556

Region 253-556 7 PWM

Residues
304 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF13912 · C2H2-type zinc finger PF00096 · Zinc finger, C2H2 type
3D models
8 active PDBs · 6 summary rows
Templates
1LLM, 2I13, 5EGB, 5EI9, 5V3J, 5V3M, 5WJQ, 7W1M
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
8 active PDB models 6 summary rows
Region 253-5568 models · 6 summary rows
Actions
Predicted = Low DIMER_sp_Q8N895_ZN366_HUMAN:502:556_1llm_C_1 1llm 502-556 View model · PDB
Predicted = Low TFS_sp_Q8N895_ZN366_HUMAN:253:551_7w1m_H_1 7w1m 253-551 View model · PDB
Predicted = Low TFS_sp_Q8N895_ZN366_HUMAN:279:387_5egb_A_1 5egb 279-387 View model · PDB
Predicted = Low TFS_sp_Q8N895_ZN366_HUMAN:279:387_5ei9_E_1 5ei9 279-387 View model · PDB
Predicted = Low TFS_sp_Q8N895_ZN366_HUMAN:279:554_5wjq_D_1 5wjq 279-554 View model · PDB
Predicted = Low TFS_sp_Q8N895_ZN366_HUMAN:280:554_5v3j_E_1 5v3j 280-554 View model · PDB
Predicted = Low TFS_sp_Q8N895_ZN366_HUMAN:280:554_5v3m_C_1 5v3m 280-554 View model · PDB
Predicted = Low TFS_sp_Q8N895_ZN366_HUMAN:290:443_2i13_A_1 2i13 290-443 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 5v3m 248:557 280 554 P:C · DNA:A,B 38.5% / 49.8% 99 View · PDB TFS_sp_Q8N895_ZN366_HUMAN:280:554_5v3m_C_1
2 5v3j 248:557 280 554 P:E · DNA:A,B 38.5% / 49.8% 99 View · PDB TFS_sp_Q8N895_ZN366_HUMAN:280:554_5v3j_E_1
5 2i13 248:557 290 443 P:A · DNA:C,D 37.7% / 48.7% 100 View · PDB TFS_sp_Q8N895_ZN366_HUMAN:290:443_2i13_A_1
3 5wjq 248:557 279 554 P:D · DNA:A,B 37.0% / 50.4% 98 View · PDB TFS_sp_Q8N895_ZN366_HUMAN:279:554_5wjq_D_1
1 1llm 248:557 502,502 556,556 P:C,D · DNA:A,B 36.4% / 56.4% 63,64 View · PDB DIMER_sp_Q8N895_ZN366_HUMAN:502:556_1llm_C_1
4 7w1m 248:557 253 551 P:H · DNA:F,G 29.2% / 43.8% 92 View · PDB TFS_sp_Q8N895_ZN366_HUMAN:253:551_7w1m_H_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
254-275PF00096Zinc finger, C2H2 typeoverlaps 253-556
281-303PF00096Zinc finger, C2H2 typeoverlaps 253-556
309-331PF00096Zinc finger, C2H2 typeoverlaps 253-556
337-359PF00096Zinc finger, C2H2 typeoverlaps 253-556
367-387PF00096Zinc finger, C2H2 typeoverlaps 253-556
393-415PF00096Zinc finger, C2H2 typeoverlaps 253-556
421-443PF00096Zinc finger, C2H2 typeoverlaps 253-556
449-471PF00096Zinc finger, C2H2 typeoverlaps 253-556
477-499PF00096Zinc finger, C2H2 typeoverlaps 253-556
505-527PF13912C2H2-type zinc fingeroverlaps 253-556
533-556PF00096Zinc finger, C2H2 typeoverlaps 253-556