Transcription factor

Q8N8E2 - ZNF513

Zinc finger protein 513

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 541 aa

15 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
M08322_2.00	Known	CisBP	ACCATCATCATCATC	Direct PWM		Open · Scan

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)8

Motif	Prediction	Source	DNA binding	Support	Actions
M01538_2.00	NN 70-40%	CisBP	GCCCCTGA	52.6% identity	Open · Scan
M00909_2.00	NN 70-40%	CisBP	AGGACCCTGT	51.2% identity	Open · Scan
M01447_2.00	NN 70-40%	CisBP	TACCCCTGA	51.2% identity	Open · Scan
M01456_2.00	NN 70-40%	CisBP	GTGATCGGCG	51.2% identity	Open · Scan
M08540_2.00	NN 70-40%	CisBP	CCCCT	51.2% identity	Open · Scan
M00134_2.00	NN 70-40%	CisBP	GCCACGCCCA	50.8% identity	Open · Scan
M01883_2.00	NN 70-40%	CisBP	TGCCCCTGA	50.0% identity	Open · Scan
MA0599.1	NN 70-40%	JASPAR	GCCCCGCCCC	50.0% identity	Open · Scan

ModCRE6

Motif	Prediction	Source	DNA binding	Support	Actions
DIMER_sp_Q8N8E2_ZN513_HUMAN:442:493_1llm_D_1	ModCRE	Homology model	ACCGCGCGCGGG	Region 442-493 · 1 3D model	Open · Scan
TFS_sp_Q8N8E2_ZN513_HUMAN:358:494_2i13_A_1	ModCRE	Homology model	CCCCGCGGCCGGGGGCCCTCA	Region 358-494 · 1 3D model	Open · Scan
TFS_sp_Q8N8E2_ZN513_HUMAN:360:494_5wjq_D_1	ModCRE	Homology model	TTGGGGAGACGGGGGCCTGT	Region 360-494 · 1 3D model	Open · Scan
TFS_sp_Q8N8E2_ZN513_HUMAN:360:494_8sss_A_1	ModCRE	Homology model	GCCCCTCGGAAGAGGGAGTGG	Region 360-494 · 1 3D model	Open · Scan
TFS_sp_Q8N8E2_ZN513_HUMAN:360:494_8sst_A_1	ModCRE	Homology model	GCCCCCTAGAAGAGGGTGCGC	Region 360-494 · 1 3D model	Open · Scan
TFS_sp_Q8N8E2_ZN513_HUMAN:362:477_5t0u_A_1	ModCRE	Homology model	AAAGGGGGGGCGCGGCCTGCC	Region 362-477 · 1 3D model	Open · Scan

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 541 aa

358-494

Residues: 137 aa
Domains: PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models: 6 active PDBs · 6 summary rows
Templates: 1LLM, 2I13, 5T0U, 5WJQ, 8SSS, 8SST
Sources: Predicted = Low

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

6 active PDB models 6 summary rows

Region 358-4946 models · 6 summary rows

Model-summary evidence imported for this region.

Rank	Template	Domain	N-tails	C-tails	Chains	Identity / similarity	Coverage	Model file
5	5t0u	357:500	362	477	P:A · DNA:B,C	45.3% / 60.7%	68	View · PDB TFS_sp_Q8N8E2_ZN513_HUMAN:362:477_5t0u_A_1
2	2i13	357:500	358	494	P:A · DNA:C,D	40.9% / 56.9%	90	View · PDB TFS_sp_Q8N8E2_ZN513_HUMAN:358:494_2i13_A_1
3	8sst	357:500	360	494	P:A · DNA:B,C	40.4% / 58.8%	68	View · PDB TFS_sp_Q8N8E2_ZN513_HUMAN:360:494_8sst_A_1
4	8sss	357:500	360	494	P:A · DNA:B,C	40.4% / 58.8%	68	View · PDB TFS_sp_Q8N8E2_ZN513_HUMAN:360:494_8sss_A_1
1	1llm	357:500	442,442	493,493	P:C,D · DNA:A,B	40.4% / 57.7%	59,61	View · PDB DIMER_sp_Q8N8E2_ZN513_HUMAN:442:493_1llm_D_1
1	5wjq	357:500	360	494	P:D · DNA:A,B	37.0% / 52.6%	47	View · PDB TFS_sp_Q8N8E2_ZN513_HUMAN:360:494_5wjq_D_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
178-200	PF00096	Zinc finger, C2H2 type	No overlap with loaded model regions
206-228	PF00096	Zinc finger, C2H2 type	No overlap with loaded model regions
388-410	PF00096	Zinc finger, C2H2 type	overlaps 358-494
416-438	PF00096	Zinc finger, C2H2 type	overlaps 358-494
444-466	PF00096	Zinc finger, C2H2 type	overlaps 358-494