Transcription factor

Q8NA42 - ZNF383

Zinc finger protein 383

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 475 aa

3 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known3

Motif	Prediction	Source	DNA binding	Support	Actions
M07689_2.00	Known	CisBP	ACCCAGGCTCCTTCCATCTTGTGGCTC	Direct PWM	Open · Scan
MA1979.1	Known	JASPAR	TATCTGGGCAC	Direct PWM	Open · Scan
MA1979.2	Known	JASPAR	TATCTGGGCA	Direct PWM	Open · Scan

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 475 aa

167-445

Residues: 279 aa
Domains: PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF13465 · Zinc-finger double domain
3D models: 1 active PDB
Templates: 5WJQ
Sources: Structure model

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 167-4451 model

				Actions
Predicted = Low	TFS_Q8NA42:167:445_5wjq_D_1	5wjq	167-445	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
5-46	PF01352	KRAB box	No overlap with loaded model regions
170-192	PF00096	Zinc finger, C2H2 type	overlaps 167-445
226-248	PF00096	Zinc finger, C2H2 type	overlaps 167-445
254-276	PF00096	Zinc finger, C2H2 type	overlaps 167-445
282-304	PF00096	Zinc finger, C2H2 type	overlaps 167-445
310-332	PF00096	Zinc finger, C2H2 type	overlaps 167-445
338-360	PF00096	Zinc finger, C2H2 type	overlaps 167-445
366-388	PF00096	Zinc finger, C2H2 type	overlaps 167-445
394-416	PF00096	Zinc finger, C2H2 type	overlaps 167-445
436-461	PF13465	Zinc-finger double domain	overlaps 167-445