ModCRE DB

Transcription factor

Q8NB15 - ZNF511

Zinc finger protein 511

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 252 aa

4 Generated PWM 4 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE4
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_sp_Q8NB15_ZN511_HUMAN:144:169_1tf3_A_1 ModCRE Homology model ACACATGGTTTT Region 144-169 · 1 3D model Open · Scan
TFS_sp_Q8NB15_ZN511_HUMAN:144:169_2gli_A_1 ModCRE Homology model CCAAATTGGGGGCC Region 144-169 · 1 3D model Open · Scan
TFS_sp_Q8NB15_ZN511_HUMAN:73:169_8ffz_A_1 ModCRE Homology model AACGGGGCGGGGGCGGGTGCC Region 73-169 · 1 3D model Open · Scan
TFS_sp_Q8NB15_ZN511_HUMAN:81:169_1ubd_C_1 ModCRE Homology model TTAGGGGGGTTTTAAG Region 81-169 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 252 aa
73-169

Region 73-169 4 PWM

Residues
97 aa
Domains
No overlapping PFAM annotation recorded
3D models
4 active PDBs · 4 summary rows
Templates
1TF3, 1UBD, 2GLI, 8FFZ
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
4 active PDB models 4 summary rows
Region 73-1694 models · 4 summary rows
Actions
Predicted = Low TFS_sp_Q8NB15_ZN511_HUMAN:144:169_1tf3_A_1 1tf3 144-169 View model · PDB
Predicted = Low TFS_sp_Q8NB15_ZN511_HUMAN:144:169_2gli_A_1 2gli 144-169 View model · PDB
Predicted = Low TFS_sp_Q8NB15_ZN511_HUMAN:73:169_8ffz_A_1 8ffz 73-169 View model · PDB
Predicted = Low TFS_sp_Q8NB15_ZN511_HUMAN:81:169_1ubd_C_1 1ubd 81-169 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
2 2gli 73:169 144 169 P:A · DNA:C,D 42.3% / 53.8% 16 View · PDB TFS_sp_Q8NB15_ZN511_HUMAN:144:169_2gli_A_1
4 1tf3 73:169 144 169 P:A · DNA:E,F 34.6% / 50.0% 28 View · PDB TFS_sp_Q8NB15_ZN511_HUMAN:144:169_1tf3_A_1
3 1ubd 73:169 81 169 P:C · DNA:A,B 30.4% / 45.7% 68 View · PDB TFS_sp_Q8NB15_ZN511_HUMAN:81:169_1ubd_C_1
1 8ffz 73:169 73 169 P:A · DNA:I,J 26.3% / 39.4% 28 View · PDB TFS_sp_Q8NB15_ZN511_HUMAN:73:169_8ffz_A_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Imported domain tags3
RAG2_PHDzf-C2H2zf-C2H2_4