Region 214-410 0 PWM
- Residues
- 197 aa
- Domains
- PF13465 · Zinc-finger double domain PF00096 · Zinc finger, C2H2 type
- 3D models
- 1 active PDB
- Templates
- 5V3J
- Sources
- Structure model
Transcription factor
Q8NC26 - ZNF114
Zinc finger protein 114
Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 417 aa
Motif Prediction
Only entries with a generated matrix are shown here.
Known1
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| M07650_2.00 | Known | CisBP | GGTCTATAAAAGGGGGGCCGCGGGGGGG | Direct PWM | Open · Scan |
Nearest Neighbor (>70%)0
No generated PWM in this category.
Nearest Neighbor (70% - 40%)0
No generated PWM in this category.
ModCRE0
No generated PWM in this category.
Model-supported DNA-binding regions
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
1
417 aa
214-410
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
Region 214-4101 model
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | TFS_Q8NC26:214:410_5v3j_E_1 | 5v3j | 214-410 | View model · PDB |
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Domains
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 5-45 | PF01352 | KRAB box | No overlap with loaded model regions |
| 319-343 | PF13465 | Zinc-finger double domain | overlaps 214-410 |
| 388-410 | PF00096 | Zinc finger, C2H2 type | overlaps 214-410 |