ModCRE DB

Transcription factor

Q8NCP5 - ZBTB44

Zinc finger and BTB domain-containing protein 44 (BTB/POZ domain-containing protein 15) (Zinc finger protein 851)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 570 aa

10 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1
MotifPredictionSourceDNA bindingSupportLogoActions
M01173_2.00 Known CisBP TGGATGCATCT Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)3
MotifPredictionSourceDNA bindingSupportLogoActions
M01196_2.00 NN 70-40% CisBP AGCATGCCTC 55.0% identity Open · Scan
M08529_2.00 NN 70-40% CisBP TGCCAAG 51.8% identity Open · Scan
M08320_2.00 NN 70-40% CisBP TTCCCTGCC 51.3% identity Open · Scan
ModCRE6
MotifPredictionSourceDNA bindingSupportLogoActions
DIMER_sp_Q8NCP5_ZBT44_HUMAN:397:446_1llm_C_1 ModCRE Homology model CGCGCGCGCGCC Region 397-446 · 1 3D model Open · Scan
TFS_sp_Q8NCP5_ZBT44_HUMAN:396:475_7n5t_A_1 ModCRE Homology model TGGATCCCCGGGGC Region 396-475 · 1 3D model Open · Scan
TFS_sp_Q8NCP5_ZBT44_HUMAN:396:475_8e3d_A_1 ModCRE Homology model TCCCCTTATTTTTAATCG Region 396-475 · 1 3D model Open · Scan
TFS_sp_Q8NCP5_ZBT44_HUMAN:396:475_8e3e_A_1 ModCRE Homology model CCCCCGAGTCTATATTA Region 396-475 · 1 3D model Open · Scan
TFS_sp_Q8NCP5_ZBT44_HUMAN:396:507_6wmi_A_1 ModCRE Homology model GGGGGGGGGGGAGGACT Region 396-507 · 1 3D model Open · Scan
TFS_sp_Q8NCP5_ZBT44_HUMAN:397:508_2i13_A_1 ModCRE Homology model TTTTGTTAGAGACTGGCAAGT Region 397-508 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 570 aa
396-508

Region 396-508 6 PWM

Residues
113 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
6 active PDBs · 6 summary rows
Templates
1LLM, 2I13, 6WMI, 7N5T, 8E3D, 8E3E
Sources
Predicted = Low
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models 6 summary rows
Region 396-5086 models · 6 summary rows
Actions
Predicted = Low DIMER_sp_Q8NCP5_ZBT44_HUMAN:397:446_1llm_C_1 1llm 397-446 View model · PDB
Predicted = Low TFS_sp_Q8NCP5_ZBT44_HUMAN:396:475_7n5t_A_1 7n5t 396-475 View model · PDB
Predicted = Low TFS_sp_Q8NCP5_ZBT44_HUMAN:396:475_8e3d_A_1 8e3d 396-475 View model · PDB
Predicted = Low TFS_sp_Q8NCP5_ZBT44_HUMAN:396:475_8e3e_A_1 8e3e 396-475 View model · PDB
Predicted = Low TFS_sp_Q8NCP5_ZBT44_HUMAN:396:507_6wmi_A_1 6wmi 396-507 View model · PDB
Predicted = Low TFS_sp_Q8NCP5_ZBT44_HUMAN:397:508_2i13_A_1 2i13 397-508 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 1llm 379:513 397,397 446,446 P:C,D · DNA:A,B 48.0% / 62.0% 57,58 View · PDB DIMER_sp_Q8NCP5_ZBT44_HUMAN:397:446_1llm_C_1
2 6wmi 379:513 396 507 P:A · DNA:E,F 41.5% / 55.9% 73 View · PDB TFS_sp_Q8NCP5_ZBT44_HUMAN:396:507_6wmi_A_1
3 8e3e 379:513 396 475 P:A · DNA:X,Y 40.0% / 53.8% 72 View · PDB TFS_sp_Q8NCP5_ZBT44_HUMAN:396:475_8e3e_A_1
4 8e3d 379:513 396 475 P:A · DNA:X,Y 40.0% / 53.8% 72 View · PDB TFS_sp_Q8NCP5_ZBT44_HUMAN:396:475_8e3d_A_1
5 7n5t 379:513 396 475 P:A · DNA:X,Y 40.0% / 53.8% 72 View · PDB TFS_sp_Q8NCP5_ZBT44_HUMAN:396:475_7n5t_A_1
1 2i13 379:513 397 508 P:A · DNA:C,D 33.9% / 55.4% 71 View · PDB TFS_sp_Q8NCP5_ZBT44_HUMAN:397:508_2i13_A_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
21-127PF00651BTB/POZ domainNo overlap with loaded model regions
399-421PF00096Zinc finger, C2H2 typeoverlaps 396-508
427-449PF00096Zinc finger, C2H2 typeoverlaps 396-508
487-511PF00096Zinc finger, C2H2 typeoverlaps 396-508