Transcription factor

Q8NCP5 - ZBTB44

Zinc finger and BTB domain-containing protein 44 (BTB/POZ domain-containing protein 15) (Zinc finger protein 851)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 570 aa

10 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
M01173_2.00	Known	CisBP	TGGATGCATCT	Direct PWM		Open · Scan

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)3

Motif	Prediction	Source	DNA binding	Support	Actions
M01196_2.00	NN 70-40%	CisBP	AGCATGCCTC	55.0% identity	Open · Scan
M08529_2.00	NN 70-40%	CisBP	TGCCAAG	51.8% identity	Open · Scan
M08320_2.00	NN 70-40%	CisBP	TTCCCTGCC	51.3% identity	Open · Scan

ModCRE6

Motif	Prediction	Source	DNA binding	Support	Actions
DIMER_sp_Q8NCP5_ZBT44_HUMAN:397:446_1llm_C_1	ModCRE	Homology model	CGCGCGCGCGCC	Region 397-446 · 1 3D model	Open · Scan
TFS_sp_Q8NCP5_ZBT44_HUMAN:396:475_7n5t_A_1	ModCRE	Homology model	TGGATCCCCGGGGC	Region 396-475 · 1 3D model	Open · Scan
TFS_sp_Q8NCP5_ZBT44_HUMAN:396:475_8e3d_A_1	ModCRE	Homology model	TCCCCTTATTTTTAATCG	Region 396-475 · 1 3D model	Open · Scan
TFS_sp_Q8NCP5_ZBT44_HUMAN:396:475_8e3e_A_1	ModCRE	Homology model	CCCCCGAGTCTATATTA	Region 396-475 · 1 3D model	Open · Scan
TFS_sp_Q8NCP5_ZBT44_HUMAN:396:507_6wmi_A_1	ModCRE	Homology model	GGGGGGGGGGGAGGACT	Region 396-507 · 1 3D model	Open · Scan
TFS_sp_Q8NCP5_ZBT44_HUMAN:397:508_2i13_A_1	ModCRE	Homology model	TTTTGTTAGAGACTGGCAAGT	Region 397-508 · 1 3D model	Open · Scan

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 570 aa

396-508

Residues: 113 aa
Domains: PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models: 6 active PDBs · 6 summary rows
Templates: 1LLM, 2I13, 6WMI, 7N5T, 8E3D, 8E3E
Sources: Predicted = Low

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

6 active PDB models 6 summary rows

Region 396-5086 models · 6 summary rows

Model-summary evidence imported for this region.

Rank	Template	Domain	N-tails	C-tails	Chains	Identity / similarity	Coverage	Model file
1	1llm	379:513	397,397	446,446	P:C,D · DNA:A,B	48.0% / 62.0%	57,58	View · PDB DIMER_sp_Q8NCP5_ZBT44_HUMAN:397:446_1llm_C_1
2	6wmi	379:513	396	507	P:A · DNA:E,F	41.5% / 55.9%	73	View · PDB TFS_sp_Q8NCP5_ZBT44_HUMAN:396:507_6wmi_A_1
3	8e3e	379:513	396	475	P:A · DNA:X,Y	40.0% / 53.8%	72	View · PDB TFS_sp_Q8NCP5_ZBT44_HUMAN:396:475_8e3e_A_1
4	8e3d	379:513	396	475	P:A · DNA:X,Y	40.0% / 53.8%	72	View · PDB TFS_sp_Q8NCP5_ZBT44_HUMAN:396:475_8e3d_A_1
5	7n5t	379:513	396	475	P:A · DNA:X,Y	40.0% / 53.8%	72	View · PDB TFS_sp_Q8NCP5_ZBT44_HUMAN:396:475_7n5t_A_1
1	2i13	379:513	397	508	P:A · DNA:C,D	33.9% / 55.4%	71	View · PDB TFS_sp_Q8NCP5_ZBT44_HUMAN:397:508_2i13_A_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
21-127	PF00651	BTB/POZ domain	No overlap with loaded model regions
399-421	PF00096	Zinc finger, C2H2 type	overlaps 396-508
427-449	PF00096	Zinc finger, C2H2 type	overlaps 396-508
487-511	PF00096	Zinc finger, C2H2 type	overlaps 396-508