ModCRE DB

Transcription factor

Q8NEP9 - ZNF555

Zinc finger protein 555

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 628 aa

36 Generated PWM 7 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1
MotifPredictionSourceDNA bindingSupportLogoActions
M07682_2.00 Known CisBP CACACCCTCACCATAAGAGCTGGCGCCCGC Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)30
MotifPredictionSourceDNA bindingSupportLogoActions
M00939_2.00 NN 70-40% CisBP CCACCTCA 63.6% identity Open · Scan
M00960_2.00 NN 70-40% CisBP TGCATCCC 62.5% identity Open · Scan
M07733_2.00 NN 70-40% CisBP TCTTTCTCTCTCTCC 61.9% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 61.3% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 61.3% identity Open · Scan
M00948_2.00 NN 70-40% CisBP GCAGCACC 60.2% identity Open · Scan
M00950_2.00 NN 70-40% CisBP GCAGCCCA 60.2% identity Open · Scan
M00959_2.00 NN 70-40% CisBP GCCCTCCC 60.2% identity Open · Scan
M00955_2.00 NN 70-40% CisBP ACGTCCTCT 59.0% identity Open · Scan
M00958_2.00 NN 70-40% CisBP CGGCATCCC 59.0% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 58.3% identity Open · Scan
M00953_2.00 NN 70-40% CisBP ATCTATAT 57.9% identity Open · Scan
M04387_2.00 NN 70-40% CisBP CGTGCTCCCC 55.8% identity Open · Scan
M00945_2.00 NN 70-40% CisBP CACCGCAC 55.5% identity Open · Scan
M01474_2.00 NN 70-40% CisBP CGCCGATCAC 54.9% identity Open · Scan
M04598_2.00 NN 70-40% CisBP CGCTAACTCTCCACA 54.3% identity Open · Scan
M08254_2.00 NN 70-40% CisBP CTGCCCTGGGACTTT 53.6% identity Open · Scan
M07770_2.00 NN 70-40% CisBP CTTGGACTT 53.2% identity Open · Scan
M08263_2.00 NN 70-40% CisBP ATCTCGGCACTTTGGGAGGCCA 52.5% identity Open · Scan
M08325_2.00 NN 70-40% CisBP TTTTTTTTT 52.4% identity Open · Scan
MA1124.1 NN 70-40% JASPAR CATTCATTCATTC 52.2% identity Open · Scan
M08375_2.00 NN 70-40% CisBP TTCCCCATTGGCTACTGCACCGGTCCT 51.5% identity Open · Scan
M08985_2.00 NN 70-40% CisBP TGAGGACCTACTGTGTGCC 51.5% identity Open · Scan
M02924_2.00 NN 70-40% CisBP AGTGTTAACAGAACACCT 51.3% identity Open · Scan
M00782_2.00 NN 70-40% CisBP AGTGTGCGCTA 51.2% identity Open · Scan
M01456_2.00 NN 70-40% CisBP GTGATCGGCG 50.9% identity Open · Scan
M07648_2.00 NN 70-40% CisBP GCTTGCAAAAAAAATTTAACTCCCAGCTC 50.4% identity Open · Scan
M08267_2.00 NN 70-40% CisBP CAGTTTCATTTTCC 50.2% identity Open · Scan
M08283_2.00 NN 70-40% CisBP GACTTTTATTTT 50.2% identity Open · Scan
M07562_2.00 NN 70-40% CisBP GAAAAAAAC 50.0% identity Open · Scan
ModCRE5
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_sp_Q8NEP9_ZN555_HUMAN:119:168_2i13_A_1 ModCRE Homology model ATTTACACAGTCTCCC Region 119-168 · 1 3D model Open · Scan
TFS_sp_Q8NEP9_ZN555_HUMAN:171:447_5v3j_E_1 ModCRE Homology model CCCGGGGGGGCCCCCCCCCCTGGTCC Region 171-447 · 1 3D model Open · Scan
TFS_sp_Q8NEP9_ZN555_HUMAN:171:447_5v3m_C_1 ModCRE Homology model GGGGCCACCCCAGCGTCCCACCACCC Region 171-447 · 1 3D model Open · Scan
TFS_sp_Q8NEP9_ZN555_HUMAN:197:474_5wjq_D_1 ModCRE Homology model CCGGCCAGTCCCCCCACGTCCCCCTAGA Region 197-474 · 1 3D model Open · Scan
TFS_sp_Q8NEP9_ZN555_HUMAN:293:446_2i13_A_1 ModCRE Homology model TTGAAGATTTAGTAGAAAAGT Region 293-446 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 628 aa
119-168
170-582

Region 119-168 1 PWM

Residues
50 aa
Domains
No overlapping PFAM annotation recorded
3D models
1 active PDB
Templates
2I13
Sources
Predicted = Low
Scan this region Show models

Region 170-582 4 PWM

Residues
413 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF13894 · C2H2-type zinc finger
3D models
6 active PDBs · 6 summary rows
Templates
1LLM, 2I13, 5V3J, 5V3M, 5WJQ, 7W1M
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
7 active PDB models 6 summary rows
Region 119-1681 model
Actions
Predicted = Low TFS_sp_Q8NEP9_ZN555_HUMAN:119:168_2i13_A_1 2i13 119-168 View model · PDB
Region 170-5826 models · 6 summary rows
Actions
Predicted = Low DIMER_sp_Q8NEP9_ZN555_HUMAN:170:218_1llm_D_1 1llm 170-218 View model · PDB
Predicted = Low TFS_sp_Q8NEP9_ZN555_HUMAN:171:447_5v3j_E_1 5v3j 171-447 View model · PDB
Predicted = Low TFS_sp_Q8NEP9_ZN555_HUMAN:171:447_5v3m_C_1 5v3m 171-447 View model · PDB
Predicted = Low TFS_sp_Q8NEP9_ZN555_HUMAN:197:474_5wjq_D_1 5wjq 197-474 View model · PDB
Predicted = Low TFS_sp_Q8NEP9_ZN555_HUMAN:284:582_7w1m_H_1 7w1m 284-582 View model · PDB
Predicted = Low TFS_sp_Q8NEP9_ZN555_HUMAN:293:446_2i13_A_1 2i13 293-446 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 5wjq 168:596 197 474 P:D · DNA:A,B 51.4% / 67.3% 98 View · PDB TFS_sp_Q8NEP9_ZN555_HUMAN:197:474_5wjq_D_1
5 2i13 168:596 293 446 P:A · DNA:C,D 51.3% / 64.9% 100 View · PDB TFS_sp_Q8NEP9_ZN555_HUMAN:293:446_2i13_A_1
2 5v3m 168:596 171 447 P:C · DNA:A,B 50.9% / 67.1% 100 View · PDB TFS_sp_Q8NEP9_ZN555_HUMAN:171:447_5v3m_C_1
3 5v3j 168:596 171 447 P:E · DNA:A,B 50.9% / 67.1% 100 View · PDB TFS_sp_Q8NEP9_ZN555_HUMAN:171:447_5v3j_E_1
1 1llm 168:596 170,170 218,218 P:C,D · DNA:A,B 44.9% / 65.3% 56,57 View · PDB DIMER_sp_Q8NEP9_ZN555_HUMAN:170:218_1llm_D_1
4 7w1m 168:596 284 582 P:H · DNA:F,G 33.4% / 49.4% 92 View · PDB TFS_sp_Q8NEP9_ZN555_HUMAN:284:582_7w1m_H_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
3-44PF01352KRAB boxNo overlap with loaded model regions
172-194PF00096Zinc finger, C2H2 typeoverlaps 170-582
200-222PF00096Zinc finger, C2H2 typeoverlaps 170-582
228-250PF00096Zinc finger, C2H2 typeoverlaps 170-582
256-278PF00096Zinc finger, C2H2 typeoverlaps 170-582
284-306PF00096Zinc finger, C2H2 typeoverlaps 170-582
312-334PF00096Zinc finger, C2H2 typeoverlaps 170-582
340-362PF00096Zinc finger, C2H2 typeoverlaps 170-582
368-390PF00096Zinc finger, C2H2 typeoverlaps 170-582
396-418PF00096Zinc finger, C2H2 typeoverlaps 170-582
424-446PF00096Zinc finger, C2H2 typeoverlaps 170-582
452-474PF00096Zinc finger, C2H2 typeoverlaps 170-582
508-530PF00096Zinc finger, C2H2 typeoverlaps 170-582
536-558PF00096Zinc finger, C2H2 typeoverlaps 170-582
564-586PF13894C2H2-type zinc fingeroverlaps 170-582