ModCRE DB

Transcription factor

Q8NG42 - PR

Progesterone receptor (PR) (Nuclear receptor subfamily 3 group C member 3)

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 803 aa

12 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)2
MotifPredictionSourceDNA bindingSupportLogoActions
M09609_2.00 NN 70+% CisBP CCAGGAACAG 91.4% identity Open · Scan
M03923_2.00 NN 70+% CisBP AGAACACTGTGTACC 86.9% identity Open · Scan
Nearest Neighbor (70% - 40%)10
MotifPredictionSourceDNA bindingSupportLogoActions
MA0007.3 NN 70-40% JASPAR GGGAACACGGTGTACCC 61.1% identity Open · Scan
MA0007.1 NN 70-40% JASPAR ATAAGAACACCCTGTACCCGCC 60.2% identity Open · Scan
MA0007.2 NN 70-40% JASPAR AAGAACAGAATGTTC 59.8% identity Open · Scan
M05886_2.00 NN 70-40% CisBP AGTACATTTTGTTCT 57.4% identity Open · Scan
MA0727.1 NN 70-40% JASPAR GGGAACACAATGTTCCC 57.4% identity Open · Scan
M07987_2.00 NN 70-40% CisBP GCCCAGAACATTCTGTTCCCT 57.2% identity Open · Scan
MA0113.1 NN 70-40% JASPAR GGGAACATTATGTCCTAA 57.2% identity Open · Scan
M03382_2.00 NN 70-40% CisBP GGGAACACAATGTTCCC 56.5% identity Open · Scan
M02409_2.00 NN 70-40% CisBP GAGATCAA 54.4% identity Open · Scan
M06432_2.00 NN 70-40% CisBP AAAAATCAAAGGT 52.9% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 803 aa
563-635

Region 563-635 0 PWM

Residues
73 aa
Domains
PF02161 · Progesterone receptor PF00105 · Double treble clef zinc finger, C4 type
3D models
1 active PDB
Templates
4OOR
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 563-6351 model
Actions
Predicted = Low DIMER_Q8NG42:563:635_4oor_A_1 4oor 563-635 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
1-564PF02161Progesterone receptoroverlaps 563-635
566-633PF00105Double treble clef zinc finger, C4 typeoverlaps 563-635
715-787PF00104Ligand-binding domain of nuclear hormone receptorNo overlap with loaded model regions