ModCRE DB

Transcription factor

Q8TBJ5 - FEZF2

Fez family zinc finger protein 2 (Forebrain embryonic zinc finger-like protein 2) (Zinc finger protein 312) (Zinc finger protein Fez-like)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 459 aa

11 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1
MotifPredictionSourceDNA bindingSupportLogoActions
MA2341.1 Known JASPAR CCCAGCCT Direct PWM Open · Scan
Nearest Neighbor (>70%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M03686_2.00 NN 70+% CisBP TGATTGCTCTTTT 88.0% identity Open · Scan
Nearest Neighbor (70% - 40%)9
MotifPredictionSourceDNA bindingSupportLogoActions
M08889_2.00 NN 70-40% CisBP GCTGCTCTTTTT 57.9% identity Open · Scan
M08934_2.00 NN 70-40% CisBP GCTGTACCTGCTTATTAGGC 53.4% identity Open · Scan
M00955_2.00 NN 70-40% CisBP ACGTCCTCT 52.9% identity Open · Scan
M07714_2.00 NN 70-40% CisBP AGCCCATTGGGGCCTATGCCC 52.4% identity Open · Scan
M00939_2.00 NN 70-40% CisBP CCACCTCA 50.6% identity Open · Scan
M06108_2.00 NN 70-40% CisBP ACAACAACAAC 50.4% identity Open · Scan
M00609_2.00 NN 70-40% CisBP GGAAGCCCTA 50.0% identity Open · Scan
M04409_2.00 NN 70-40% CisBP GGCGGCCATTTTGG 50.0% identity Open · Scan
M08529_2.00 NN 70-40% CisBP TGCCAAG 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 459 aa
275-384

Region 275-384 0 PWM

Residues
110 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5EGB
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 275-3841 model
Actions
Predicted = Low TFS_Q8TBJ5:275:384_5egb_A_1 5egb 275-384 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
277-296PF00096Zinc finger, C2H2 typeoverlaps 275-384
305-327PF00096Zinc finger, C2H2 typeoverlaps 275-384
333-355PF00096Zinc finger, C2H2 typeoverlaps 275-384
361-383PF00096Zinc finger, C2H2 typeoverlaps 275-384
389-413PF13912C2H2-type zinc fingerNo overlap with loaded model regions
417-440PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions