ModCRE DB

Transcription factor

Q8TCN5 - ZNF507

Zinc finger protein 507

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 953 aa

6 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE6
MotifPredictionSourceDNA bindingSupportLogoActions
DIMER_sp_Q8TCN5_ZN507_HUMAN:639:687_1llm_D_1 ModCRE Homology model ATGACGCGTGTG Region 639-687 · 1 3D model Open · Scan
TFS_sp_Q8TCN5_ZN507_HUMAN:638:821_8ssq_A_1 ModCRE Homology model AAATTTGGCTCAAAAACACAGCTCGCGAAATCGT Region 638-821 · 1 3D model Open · Scan
TFS_sp_Q8TCN5_ZN507_HUMAN:638:821_8ssr_A_1 ModCRE Homology model AATTTGCCTCAAGCACATAGCTGGGAATCCCCC Region 638-821 · 1 3D model Open · Scan
TFS_sp_Q8TCN5_ZN507_HUMAN:638:821_8ssu_A_1 ModCRE Homology model CCAAATCTCTGGCGAGATC Region 638-821 · 1 3D model Open · Scan
TFS_sp_Q8TCN5_ZN507_HUMAN:641:805_8sss_A_1 ModCRE Homology model TTAAGCAGTGACGACATCGGTGA Region 641-805 · 1 3D model Open · Scan
TFS_sp_Q8TCN5_ZN507_HUMAN:641:805_8sst_A_1 ModCRE Homology model GGCCGATGGCGGTGTGGGGCGGG Region 641-805 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 953 aa
638-821

Region 638-821 6 PWM

Residues
184 aa
Domains
PF00096 · Zinc finger, C2H2 type
3D models
6 active PDBs · 6 summary rows
Templates
1LLM, 8SSQ, 8SSR, 8SSS, 8SST, 8SSU
Sources
Predicted = Low
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models 6 summary rows
Region 638-8216 models · 6 summary rows
Actions
Predicted = Low DIMER_sp_Q8TCN5_ZN507_HUMAN:639:687_1llm_D_1 1llm 639-687 View model · PDB
Predicted = Low TFS_sp_Q8TCN5_ZN507_HUMAN:638:821_8ssq_A_1 8ssq 638-821 View model · PDB
Predicted = Low TFS_sp_Q8TCN5_ZN507_HUMAN:638:821_8ssr_A_1 8ssr 638-821 View model · PDB
Predicted = Low TFS_sp_Q8TCN5_ZN507_HUMAN:638:821_8ssu_A_1 8ssu 638-821 View model · PDB
Predicted = Low TFS_sp_Q8TCN5_ZN507_HUMAN:641:805_8sss_A_1 8sss 641-805 View model · PDB
Predicted = Low TFS_sp_Q8TCN5_ZN507_HUMAN:641:805_8sst_A_1 8sst 641-805 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 1llm 629:822 639,639 687,687 P:C,D · DNA:A,B 26.5% / 49.0% 56,57 View · PDB DIMER_sp_Q8TCN5_ZN507_HUMAN:639:687_1llm_D_1
3 8sst 629:822 641 805 P:A · DNA:B,C 22.4% / 46.1% 81 View · PDB TFS_sp_Q8TCN5_ZN507_HUMAN:641:805_8sst_A_1
4 8sss 629:822 641 805 P:A · DNA:B,C 22.4% / 46.1% 81 View · PDB TFS_sp_Q8TCN5_ZN507_HUMAN:641:805_8sss_A_1
1 8ssr 629:822 638 821 P:A · DNA:B,C 21.7% / 44.6% 70 View · PDB TFS_sp_Q8TCN5_ZN507_HUMAN:638:821_8ssr_A_1
2 8ssq 629:822 638 821 P:A · DNA:B,C 21.7% / 44.6% 70 View · PDB TFS_sp_Q8TCN5_ZN507_HUMAN:638:821_8ssq_A_1
5 8ssu 629:822 638 821 P:A · DNA:B,C 21.7% / 44.6% 78 View · PDB TFS_sp_Q8TCN5_ZN507_HUMAN:638:821_8ssu_A_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
697-720PF00096Zinc finger, C2H2 typeoverlaps 638-821