Transcription factor

Q8TF50 - ZNF526

Zinc finger protein 526

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 670 aa

10 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)5

Motif	Prediction	Source	DNA binding	Support	Actions
M06179_2.00	NN 70-40%	CisBP	TAAGCCTATAGA	52.0% identity	Open · Scan
M08525_2.00	NN 70-40%	CisBP	CCCCGCA	51.8% identity	Open · Scan
M00952_2.00	NN 70-40%	CisBP	GGATGCTC	51.1% identity	Open · Scan
M01883_2.00	NN 70-40%	CisBP	TGCCCCTGA	51.1% identity	Open · Scan
M00943_2.00	NN 70-40%	CisBP	CCCGCTGC	50.0% identity	Open · Scan

ModCRE5

Motif	Prediction	Source	DNA binding	Support	Actions
TFS_sp_Q8TF50_ZN526_HUMAN:304:550_5v3j_E_1	ModCRE	Homology model	GGCGCGCCGCCCCCCCCCCGGGC	Region 304-550 · 1 3D model	Open · Scan
TFS_sp_Q8TF50_ZN526_HUMAN:304:550_5v3m_C_1	ModCRE	Homology model	CGGCATTTCCGCCCCCCCGCAGTA	Region 304-550 · 1 3D model	Open · Scan
TFS_sp_Q8TF50_ZN526_HUMAN:305:550_5wjq_D_1	ModCRE	Homology model	CCGCCCTGACGGTAGCGCCACCCCGCCC	Region 305-550 · 1 3D model	Open · Scan
TFS_sp_Q8TF50_ZN526_HUMAN:444:550_2i13_A_1	ModCRE	Homology model	TTCTTTGCTTAGTTAGTTAAA	Region 444-550 · 1 3D model	Open · Scan
TFS_sp_Q8TF50_ZN526_HUMAN:444:550_5ei9_E_1	ModCRE	Homology model	TGGCCGCCCCCCCCGAAA	Region 444-550 · 1 3D model	Open · Scan

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 670 aa

304-554

Residues: 251 aa
Domains: PF13912 · C2H2-type zinc finger PF13894 · C2H2-type zinc finger PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models: 6 active PDBs · 6 summary rows
Templates: 1LLM, 2I13, 5EI9, 5V3J, 5V3M, 5WJQ
Sources: Predicted = Low

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

6 active PDB models 6 summary rows

Region 304-5546 models · 6 summary rows

Model-summary evidence imported for this region.

Rank	Template	Domain	N-tails	C-tails	Chains	Identity / similarity	Coverage	Model file
4	2i13	304:554	444	550	P:A · DNA:C,D	48.6% / 68.2%	69	View · PDB TFS_sp_Q8TF50_ZN526_HUMAN:444:550_2i13_A_1
5	5ei9	304:554	444	550	P:E · DNA:A,B	43.9% / 63.6%	94	View · PDB TFS_sp_Q8TF50_ZN526_HUMAN:444:550_5ei9_E_1
1	1llm	304:554	498,498	554,554	P:C,D · DNA:A,B	37.9% / 63.8%	65,67	View · PDB DIMER_sp_Q8TF50_ZN526_HUMAN:498:554_1llm_D_1
1	5v3m	304:554	304	550	P:C · DNA:A,B	35.2% / 50.0%	88	View · PDB TFS_sp_Q8TF50_ZN526_HUMAN:304:550_5v3m_C_1
2	5v3j	304:554	304	550	P:E · DNA:A,B	35.2% / 50.0%	88	View · PDB TFS_sp_Q8TF50_ZN526_HUMAN:304:550_5v3j_E_1
3	5wjq	304:554	305	550	P:D · DNA:A,B	34.5% / 51.0%	86	View · PDB TFS_sp_Q8TF50_ZN526_HUMAN:305:550_5wjq_D_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
332-356	PF13912	C2H2-type zinc finger	overlaps 304-554
443-465	PF13894	C2H2-type zinc finger	overlaps 304-554
472-494	PF00096	Zinc finger, C2H2 type	overlaps 304-554
500-522	PF00096	Zinc finger, C2H2 type	overlaps 304-554
528-550	PF00096	Zinc finger, C2H2 type	overlaps 304-554