ModCRE DB

Transcription factor

Q8TF50 - ZNF526

Zinc finger protein 526

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 670 aa

10 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)5
MotifPredictionSourceDNA bindingSupportLogoActions
M06179_2.00 NN 70-40% CisBP TAAGCCTATAGA 52.0% identity Open · Scan
M08525_2.00 NN 70-40% CisBP CCCCGCA 51.8% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 51.1% identity Open · Scan
M01883_2.00 NN 70-40% CisBP TGCCCCTGA 51.1% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 50.0% identity Open · Scan
ModCRE5
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_sp_Q8TF50_ZN526_HUMAN:304:550_5v3j_E_1 ModCRE Homology model GGCGCGCCGCCCCCCCCCCGGGC Region 304-550 · 1 3D model Open · Scan
TFS_sp_Q8TF50_ZN526_HUMAN:304:550_5v3m_C_1 ModCRE Homology model CGGCATTTCCGCCCCCCCGCAGTA Region 304-550 · 1 3D model Open · Scan
TFS_sp_Q8TF50_ZN526_HUMAN:305:550_5wjq_D_1 ModCRE Homology model CCGCCCTGACGGTAGCGCCACCCCGCCC Region 305-550 · 1 3D model Open · Scan
TFS_sp_Q8TF50_ZN526_HUMAN:444:550_2i13_A_1 ModCRE Homology model TTCTTTGCTTAGTTAGTTAAA Region 444-550 · 1 3D model Open · Scan
TFS_sp_Q8TF50_ZN526_HUMAN:444:550_5ei9_E_1 ModCRE Homology model TGGCCGCCCCCCCCGAAA Region 444-550 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 670 aa
304-554

Region 304-554 5 PWM

Residues
251 aa
Domains
PF13912 · C2H2-type zinc finger PF13894 · C2H2-type zinc finger PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
6 active PDBs · 6 summary rows
Templates
1LLM, 2I13, 5EI9, 5V3J, 5V3M, 5WJQ
Sources
Predicted = Low
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models 6 summary rows
Region 304-5546 models · 6 summary rows
Actions
Predicted = Low DIMER_sp_Q8TF50_ZN526_HUMAN:498:554_1llm_D_1 1llm 498-554 View model · PDB
Predicted = Low TFS_sp_Q8TF50_ZN526_HUMAN:304:550_5v3j_E_1 5v3j 304-550 View model · PDB
Predicted = Low TFS_sp_Q8TF50_ZN526_HUMAN:304:550_5v3m_C_1 5v3m 304-550 View model · PDB
Predicted = Low TFS_sp_Q8TF50_ZN526_HUMAN:305:550_5wjq_D_1 5wjq 305-550 View model · PDB
Predicted = Low TFS_sp_Q8TF50_ZN526_HUMAN:444:550_2i13_A_1 2i13 444-550 View model · PDB
Predicted = Low TFS_sp_Q8TF50_ZN526_HUMAN:444:550_5ei9_E_1 5ei9 444-550 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
4 2i13 304:554 444 550 P:A · DNA:C,D 48.6% / 68.2% 69 View · PDB TFS_sp_Q8TF50_ZN526_HUMAN:444:550_2i13_A_1
5 5ei9 304:554 444 550 P:E · DNA:A,B 43.9% / 63.6% 94 View · PDB TFS_sp_Q8TF50_ZN526_HUMAN:444:550_5ei9_E_1
1 1llm 304:554 498,498 554,554 P:C,D · DNA:A,B 37.9% / 63.8% 65,67 View · PDB DIMER_sp_Q8TF50_ZN526_HUMAN:498:554_1llm_D_1
1 5v3m 304:554 304 550 P:C · DNA:A,B 35.2% / 50.0% 88 View · PDB TFS_sp_Q8TF50_ZN526_HUMAN:304:550_5v3m_C_1
2 5v3j 304:554 304 550 P:E · DNA:A,B 35.2% / 50.0% 88 View · PDB TFS_sp_Q8TF50_ZN526_HUMAN:304:550_5v3j_E_1
3 5wjq 304:554 305 550 P:D · DNA:A,B 34.5% / 51.0% 86 View · PDB TFS_sp_Q8TF50_ZN526_HUMAN:305:550_5wjq_D_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
332-356PF13912C2H2-type zinc fingeroverlaps 304-554
443-465PF13894C2H2-type zinc fingeroverlaps 304-554
472-494PF00096Zinc finger, C2H2 typeoverlaps 304-554
500-522PF00096Zinc finger, C2H2 typeoverlaps 304-554
528-550PF00096Zinc finger, C2H2 typeoverlaps 304-554