ModCRE DB

Transcription factor

Q8WW32 - HMGB4

High mobility group protein B4

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 186 aa

1 Generated PWM 5 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE1
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_sp_Q8WW32_HMGB4_HUMAN:9:153_6cij_N_1 ModCRE Homology model CCCCGCCTCCGAAGCTCAAATTTTACCAT Region 9-153 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 186 aa
9-153

Region 9-153 1 PWM

Residues
145 aa
Domains
PF09011 · HMG-box domain PF00505 · HMG (high mobility group) box
3D models
5 active PDBs · 5 summary rows
Templates
5ZDZ, 5ZE0, 5ZE1, 5ZE2, 6CIJ
Sources
Predicted = Low
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
5 active PDB models 5 summary rows
Region 9-1535 models · 5 summary rows
Actions
Predicted = Low TFS_sp_Q8WW32_HMGB4_HUMAN:10:153_5ze0_N_1 5ze0 10-153 View model · PDB
Predicted = Low TFS_sp_Q8WW32_HMGB4_HUMAN:13:153_5zdz_N_1 5zdz 13-153 View model · PDB
Predicted = Low TFS_sp_Q8WW32_HMGB4_HUMAN:13:153_5ze1_N_1 5ze1 13-153 View model · PDB
Predicted = Low TFS_sp_Q8WW32_HMGB4_HUMAN:13:153_5ze2_N_1 5ze2 13-153 View model · PDB
Predicted = Low TFS_sp_Q8WW32_HMGB4_HUMAN:9:153_6cij_N_1 6cij 9-153 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 6cij 5:169 9 153 P:N · DNA:G,M 40.8% / 60.5% 97 View · PDB TFS_sp_Q8WW32_HMGB4_HUMAN:9:153_6cij_N_1
3 5ze2 5:169 13 153 P:N · DNA:G,M 37.8% / 54.5% 96 View · PDB TFS_sp_Q8WW32_HMGB4_HUMAN:13:153_5ze2_N_1
4 5ze1 5:169 13 153 P:N · DNA:G,M 37.8% / 54.5% 96 View · PDB TFS_sp_Q8WW32_HMGB4_HUMAN:13:153_5ze1_N_1
5 5zdz 5:169 13 153 P:N · DNA:G,M 37.8% / 54.5% 96 View · PDB TFS_sp_Q8WW32_HMGB4_HUMAN:13:153_5zdz_N_1
2 5ze0 5:169 10 153 P:N · DNA:G,M 37.0% / 54.1% 98 View · PDB TFS_sp_Q8WW32_HMGB4_HUMAN:10:153_5ze0_N_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
8-78PF09011HMG-box domainoverlaps 9-153
93-160PF00505HMG (high mobility group) boxoverlaps 9-153