Transcription factor

Q8WZ46

Zinc finger protein

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 253 aa

4 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)2

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
M08870_2.00	NN 70+%	CisBP	CCCCCCCCCCCCCCCCTCCCCC	99.2% identity		Open · Scan
MA1522.1	NN 70+%	JASPAR	CGCCCCTCCCC	95.6% identity		Open · Scan

Nearest Neighbor (70% - 40%)2

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
M08864_2.00	NN 70-40%	CisBP	CCTCCCCCCCCGCCCCCTCCCC	69.7% identity		Open · Scan
MA1578.1	NN 70-40%	JASPAR	CCCCCCACTT	65.6% identity		Open · Scan

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 253 aa

53-164

Residues: 112 aa
Domains: PF00096 · Zinc finger, C2H2 type PF13894 · C2H2-type zinc finger PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models: 1 active PDB
Templates: 5EGB
Sources: Structure model

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 53-1641 model

				Actions
Predicted = Low	TFS_Q8WZ46:53:164_5egb_A_1	5egb	53-164	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
55-77	PF00096	Zinc finger, C2H2 type	overlaps 53-164
83-105	PF13894	C2H2-type zinc finger	overlaps 53-164
113-136	PF00096	Zinc finger, C2H2 type	overlaps 53-164
142-164	PF00096	Zinc finger, C2H2 type	overlaps 53-164