ModCRE DB

Transcription factor

Q92753 - RORB

Nuclear receptor ROR-beta (Nuclear receptor RZR-beta) (Nuclear receptor subfamily 1 group F member 2) (Retinoid-related orphan receptor-beta)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 470 aa

7 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known7
MotifPredictionSourceDNA bindingSupportLogoActions
MA1150.1 Known JASPAR AATTAGGTCAC Direct PWM Open · Scan
MA1150.2 Known JASPAR AATTAGGTCA Direct PWM Open · Scan
M05677_2.00 Known CisBP TAAGTAGGTCAGTAGGTCAC Direct PWM Open · Scan
M05678_2.00 Known CisBP TAACTAGGTCATGACCTAGTTA Direct PWM Open · Scan
M05679_2.00 Known CisBP TAAGTAGGTCAGTAGGTCAC Direct PWM Open · Scan
M05680_2.00 Known CisBP TAACTAGGTCACGACCTACTTA Direct PWM Open · Scan
M05883_2.00 Known CisBP AATTAGGTCAC Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 470 aa
18-96

Region 18-96 0 PWM

Residues
79 aa
Domains
PF00105 · Double treble clef zinc finger, C4 type
3D models
1 active PDB
Templates
1HLZ
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 18-961 model
Actions
Predicted = Low DIMER_Q92753:18:96_1hlz_A_1 1hlz 18-96 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
20-88PF00105Double treble clef zinc finger, C4 typeoverlaps 18-96
270-442PF00104Ligand-binding domain of nuclear hormone receptorNo overlap with loaded model regions