Transcription factor

Q969W8 - ZNF566

Zinc finger protein 566

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 418 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
M07677_2.00	Known	CisBP	CCCCGCCTCCCTTGCCGCTGC	Direct PWM		Open · Scan

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 418 aa

159-417

Residues: 259 aa
Domains: PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF13465 · Zinc-finger double domain PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models: 1 active PDB
Templates: 5WJQ
Sources: Structure model

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 159-4171 model

				Actions
Predicted = Low	TFS_Q969W8:159:417_5wjq_D_1	5wjq	159-417	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
5-46	PF01352	KRAB box	No overlap with loaded model regions
199-221	PF00096	Zinc finger, C2H2 type	overlaps 159-417
227-249	PF00096	Zinc finger, C2H2 type	overlaps 159-417
269-294	PF13465	Zinc-finger double domain	overlaps 159-417
311-333	PF00096	Zinc finger, C2H2 type	overlaps 159-417
339-361	PF00096	Zinc finger, C2H2 type	overlaps 159-417
367-389	PF00096	Zinc finger, C2H2 type	overlaps 159-417