ModCRE DB

Transcription factor

Q96CS4 - ZNF689

Zinc finger protein 689

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 500 aa

24 Generated PWM 7 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)23
MotifPredictionSourceDNA bindingSupportLogoActions
M04590_2.00 NN 70-40% CisBP TGCGCTAACCATTGC 60.7% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 58.8% identity Open · Scan
M00948_2.00 NN 70-40% CisBP GCAGCACC 58.8% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 58.8% identity Open · Scan
M00959_2.00 NN 70-40% CisBP GCCCTCCC 58.8% identity Open · Scan
M00960_2.00 NN 70-40% CisBP TGCATCCC 58.8% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 57.6% identity Open · Scan
M00958_2.00 NN 70-40% CisBP CGGCATCCC 57.6% identity Open · Scan
M00939_2.00 NN 70-40% CisBP CCACCTCA 56.4% identity Open · Scan
M00953_2.00 NN 70-40% CisBP ATCTATAT 55.9% identity Open · Scan
M04475_2.00 NN 70-40% CisBP GATGCACGTACCGTGCCTCA 55.8% identity Open · Scan
M00950_2.00 NN 70-40% CisBP GCAGCCCA 54.7% identity Open · Scan
M03671_2.00 NN 70-40% CisBP ATTACCATACAAGTGCAC 53.3% identity Open · Scan
M00609_2.00 NN 70-40% CisBP GGAAGCCCTA 53.2% identity Open · Scan
M07720_2.00 NN 70-40% CisBP TGTGTGTGTGGGCATGTGTGTGTGCGAGT 53.1% identity Open · Scan
M02924_2.00 NN 70-40% CisBP AGTGTTAACAGAACACCT 53.0% identity Open · Scan
M00955_2.00 NN 70-40% CisBP ACGTCCTCT 52.9% identity Open · Scan
M07578_2.00 NN 70-40% CisBP CAACTCTCC 51.5% identity Open · Scan
M08325_2.00 NN 70-40% CisBP TTTTTTTTT 51.5% identity Open · Scan
M07610_2.00 NN 70-40% CisBP CCTTCTTCCTCCCCCCTGCCCACC 50.6% identity Open · Scan
M04611_2.00 NN 70-40% CisBP CTTTCGGACAC 50.0% identity Open · Scan
M08314_2.00 NN 70-40% CisBP ATTCATCAAGGTCCTCAACAATGG 50.0% identity Open · Scan
M08917_2.00 NN 70-40% CisBP GCTGAGCCATGTGGGGTGCT 50.0% identity Open · Scan
ModCRE1
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_sp_Q96CS4_ZN689_HUMAN:258:368_5ei9_E_1 ModCRE Homology model TCCCCAGCGGGGGGTCC Region 258-368 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 500 aa
174-490

Region 174-490 1 PWM

Residues
317 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
7 active PDBs · 6 summary rows
Templates
1LLM, 2I13, 5EI9, 5V3J, 5V3M, 5WJQ, 7W1M
Sources
Predicted = Low
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
7 active PDB models 6 summary rows
Region 174-4907 models · 6 summary rows
Actions
Predicted = Low DIMER_sp_Q96CS4_ZN689_HUMAN:231:271_1llm_D_1 1llm 231-271 View model · PDB
Predicted = Low TFS_sp_Q96CS4_ZN689_HUMAN:174:452_5wjq_D_1 5wjq 174-452 View model · PDB
Predicted = Low TFS_sp_Q96CS4_ZN689_HUMAN:176:452_5v3j_E_1 5v3j 176-452 View model · PDB
Predicted = Low TFS_sp_Q96CS4_ZN689_HUMAN:176:452_5v3m_C_1 5v3m 176-452 View model · PDB
Predicted = Low TFS_sp_Q96CS4_ZN689_HUMAN:205:490_7w1m_H_1 7w1m 205-490 View model · PDB
Predicted = Low TFS_sp_Q96CS4_ZN689_HUMAN:242:395_2i13_A_1 2i13 242-395 View model · PDB
Predicted = Low TFS_sp_Q96CS4_ZN689_HUMAN:258:368_5ei9_E_1 5ei9 258-368 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 1llm 174:490 231,231 271,271 P:C,D · DNA:A,B 56.1% / 61.0% 47,48 View · PDB DIMER_sp_Q96CS4_ZN689_HUMAN:231:271_1llm_D_1
4 2i13 174:490 242 395 P:A · DNA:C,D 52.6% / 65.6% 100 View · PDB TFS_sp_Q96CS4_ZN689_HUMAN:242:395_2i13_A_1
2 5v3m 174:490 176 452 P:C · DNA:A,B 43.0% / 60.6% 100 View · PDB TFS_sp_Q96CS4_ZN689_HUMAN:176:452_5v3m_C_1
3 5v3j 174:490 176 452 P:E · DNA:A,B 43.0% / 60.6% 100 View · PDB TFS_sp_Q96CS4_ZN689_HUMAN:176:452_5v3j_E_1
1 5wjq 174:490 174 452 P:D · DNA:A,B 42.7% / 62.0% 99 View · PDB TFS_sp_Q96CS4_ZN689_HUMAN:174:452_5wjq_D_1
5 7w1m 174:490 205 490 P:H · DNA:F,G 36.4% / 48.8% 88 View · PDB TFS_sp_Q96CS4_ZN689_HUMAN:205:490_7w1m_H_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
29-69PF01352KRAB boxNo overlap with loaded model regions
177-199PF00096Zinc finger, C2H2 typeoverlaps 174-490
205-227PF00096Zinc finger, C2H2 typeoverlaps 174-490
233-255PF00096Zinc finger, C2H2 typeoverlaps 174-490
261-283PF00096Zinc finger, C2H2 typeoverlaps 174-490
289-311PF00096Zinc finger, C2H2 typeoverlaps 174-490
317-339PF00096Zinc finger, C2H2 typeoverlaps 174-490
345-367PF00096Zinc finger, C2H2 typeoverlaps 174-490
373-395PF00096Zinc finger, C2H2 typeoverlaps 174-490
401-423PF00096Zinc finger, C2H2 typeoverlaps 174-490
429-451PF00096Zinc finger, C2H2 typeoverlaps 174-490