ModCRE DB

Transcription factor

Q96GE5 - ZNF799

Zinc finger protein 799 (Zinc finger protein 842)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 643 aa

36 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1
MotifPredictionSourceDNA bindingSupportLogoActions
M07705_2.00 Known CisBP GCCAATCACTGAGACAACAAGTATTGC Direct PWM Open · Scan
Nearest Neighbor (>70%)3
MotifPredictionSourceDNA bindingSupportLogoActions
M07659_2.00 NN 70+% CisBP GTCTTCCAAGTAGCTGGTGTT 89.1% identity Open · Scan
M07733_2.00 NN 70+% CisBP TCTTTCTCTCTCTCC 86.9% identity Open · Scan
M07731_2.00 NN 70+% CisBP TTTCCCAGCAGCAACAGCACCGCCCCCCCC 74.2% identity Open · Scan
Nearest Neighbor (70% - 40%)32
MotifPredictionSourceDNA bindingSupportLogoActions
M00939_2.00 NN 70-40% CisBP CCACCTCA 67.4% identity Open · Scan
M00960_2.00 NN 70-40% CisBP TGCATCCC 60.2% identity Open · Scan
M00948_2.00 NN 70-40% CisBP GCAGCACC 59.0% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 59.0% identity Open · Scan
M00958_2.00 NN 70-40% CisBP CGGCATCCC 59.0% identity Open · Scan
M07717_2.00 NN 70-40% CisBP GGCTCCGCCCCC 58.9% identity Open · Scan
M00950_2.00 NN 70-40% CisBP GCAGCCCA 57.8% identity Open · Scan
M00959_2.00 NN 70-40% CisBP GCCCTCCC 57.8% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 57.6% identity Open · Scan
M00953_2.00 NN 70-40% CisBP ATCTATAT 57.6% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 57.1% identity Open · Scan
M00945_2.00 NN 70-40% CisBP CACCGCAC 56.9% identity Open · Scan
M04653_2.00 NN 70-40% CisBP GGTACGGTTGTCCATGTTGCAA 56.4% identity Open · Scan
M08908_2.00 NN 70-40% CisBP GCTGCTGCTTCTGCTG 56.0% identity Open · Scan
M04598_2.00 NN 70-40% CisBP CGCTAACTCTCCACA 55.6% identity Open · Scan
M08254_2.00 NN 70-40% CisBP CTGCCCTGGGACTTT 55.4% identity Open · Scan
M02924_2.00 NN 70-40% CisBP AGTGTTAACAGAACACCT 54.8% identity Open · Scan
MA1588.1 NN 70-40% JASPAR GAATTCTTGGTTGAC 54.8% identity Open · Scan
M07770_2.00 NN 70-40% CisBP CTTGGACTT 53.8% identity Open · Scan
M07628_2.00 NN 70-40% CisBP AGTGGTTCTGCTTCT 53.0% identity Open · Scan
M01474_2.00 NN 70-40% CisBP CGCCGATCAC 52.9% identity Open · Scan
M00217_2.00 NN 70-40% CisBP TTACTCAATAT 52.5% identity Open · Scan
M07627_2.00 NN 70-40% CisBP CAGTCACCTTCTGG 51.8% identity Open · Scan
M00955_2.00 NN 70-40% CisBP ACGTCCTCT 51.7% identity Open · Scan
M04387_2.00 NN 70-40% CisBP CGTGCTCCCC 51.3% identity Open · Scan
M08395_2.00 NN 70-40% CisBP GCTGCCTACTCTTCC 51.2% identity Open · Scan
M07635_2.00 NN 70-40% CisBP AAGTTTTCTTGTATTATATCT 51.1% identity Open · Scan
M07685_2.00 NN 70-40% CisBP CTTTCCAGCCAC 51.1% identity Open · Scan
M04465_2.00 NN 70-40% CisBP GTGATTCTTATCTTATCCTT 50.3% identity Open · Scan
M04536_2.00 NN 70-40% CisBP ACGTAACCCGATACC 50.2% identity Open · Scan
M00609_2.00 NN 70-40% CisBP GGAAGCCCTA 50.0% identity Open · Scan
M07686_2.00 NN 70-40% CisBP TAGCTTGTTTCCAGCCAC 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 643 aa
196-304

Region 196-304 0 PWM

Residues
109 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5EGB
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 196-3041 model
Actions
Predicted = Low TFS_Q96GE5:196:304_5egb_A_1 5egb 196-304 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
3-44PF01352KRAB boxNo overlap with loaded model regions
169-189PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
225-247PF00096Zinc finger, C2H2 typeoverlaps 196-304
281-303PF00096Zinc finger, C2H2 typeoverlaps 196-304
309-331PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
337-359PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
365-387PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
393-415PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
421-443PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
476-498PF13912C2H2-type zinc fingerNo overlap with loaded model regions
504-526PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
560-582PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
588-613PF13912C2H2-type zinc fingerNo overlap with loaded model regions
623-643PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions