ModCRE DB

Transcription factor

Q96H86 - ZNF764

Zinc finger protein 764

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 408 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1
MotifPredictionSourceDNA bindingSupportLogoActions
M07623_2.00 Known CisBP GTCTAATAGAGCTGGGCTGCA Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 408 aa
159-365

Region 159-365 0 PWM

Residues
207 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5V3J
Sources
Structure model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 159-3651 model
Actions
Predicted = Low TFS_Q96H86:159:365_5v3j_E_1 5v3j 159-365 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
26-66PF01352KRAB boxNo overlap with loaded model regions
203-225PF00096Zinc finger, C2H2 typeoverlaps 159-365
231-253PF00096Zinc finger, C2H2 typeoverlaps 159-365
261-281PF00096Zinc finger, C2H2 typeoverlaps 159-365
287-309PF00096Zinc finger, C2H2 typeoverlaps 159-365
315-337PF00096Zinc finger, C2H2 typeoverlaps 159-365
343-362PF00096Zinc finger, C2H2 typeoverlaps 159-365