ModCRE DB

Transcription factor

Q96KM6 - ZNF512B

Zinc finger protein 512B

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 892 aa

5 Generated PWM 5 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE5
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_sp_Q96KM6_Z512B_HUMAN:512:639_5yel_B_1 ModCRE Homology model CTAATACGTTACTACCTTTATAAAA Region 512-639 · 1 3D model Open · Scan
TFS_sp_Q96KM6_Z512B_HUMAN:539:661_8ffz_A_1 ModCRE Homology model ACCCAGTGTCTGCCTCACATTTTTTAAT Region 539-661 · 1 3D model Open · Scan
TFS_sp_Q96KM6_Z512B_HUMAN:784:810_5k5h_A_1 ModCRE Homology model TCCTCACTCAG Region 784-810 · 1 3D model Open · Scan
TFS_sp_Q96KM6_Z512B_HUMAN:784:810_5k5i_A_1 ModCRE Homology model GTGGGGGGAT Region 784-810 · 1 3D model Open · Scan
TFS_sp_Q96KM6_Z512B_HUMAN:784:810_5k5j_A_1 ModCRE Homology model ATGCTAGGAA Region 784-810 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 892 aa
512-661
784-810

Region 512-661 2 PWM

Residues
150 aa
Domains
PF21276 · Zinc finger protein 512, C2HC zinc finger
3D models
2 active PDBs · 2 summary rows
Templates
5YEL, 8FFZ
Sources
Predicted = Low
Scan this region Show models

Region 784-810 3 PWM

Residues
27 aa
Domains
No overlapping PFAM annotation recorded
3D models
3 active PDBs · 3 summary rows
Templates
5K5H, 5K5I, 5K5J
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
5 active PDB models 5 summary rows
Region 512-6612 models · 2 summary rows
Actions
Predicted = Low TFS_sp_Q96KM6_Z512B_HUMAN:512:639_5yel_B_1 5yel 512-639 View model · PDB
Predicted = Low TFS_sp_Q96KM6_Z512B_HUMAN:539:661_8ffz_A_1 8ffz 539-661 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
2 8ffz 512:661 539 661 P:A · DNA:I,J 26.0% / 36.6% 36 View · PDB TFS_sp_Q96KM6_Z512B_HUMAN:539:661_8ffz_A_1
1 5yel 512:661 512 639 P:B · DNA:C,D 21.7% / 38.8% 73 View · PDB TFS_sp_Q96KM6_Z512B_HUMAN:512:639_5yel_B_1
Region 784-8103 models · 3 summary rows
Actions
Predicted = Low TFS_sp_Q96KM6_Z512B_HUMAN:784:810_5k5h_A_1 5k5h 784-810 View model · PDB
Predicted = Low TFS_sp_Q96KM6_Z512B_HUMAN:784:810_5k5i_A_1 5k5i 784-810 View model · PDB
Predicted = Low TFS_sp_Q96KM6_Z512B_HUMAN:784:810_5k5j_A_1 5k5j 784-810 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
3 5k5h 512:661 784 810 P:A · DNA:B,C 40.7% / 55.6% 24 View · PDB TFS_sp_Q96KM6_Z512B_HUMAN:784:810_5k5h_A_1
4 5k5i 512:661 784 810 P:A · DNA:B,C 40.7% / 55.6% 23 View · PDB TFS_sp_Q96KM6_Z512B_HUMAN:784:810_5k5i_A_1
5 5k5j 512:661 784 810 P:A · DNA:B,C 40.7% / 55.6% 23 View · PDB TFS_sp_Q96KM6_Z512B_HUMAN:784:810_5k5j_A_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
140-163PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
497-534PF21276Zinc finger protein 512, C2HC zinc fingeroverlaps 512-661
738-775PF21276Zinc finger protein 512, C2HC zinc fingerNo overlap with loaded model regions