ModCRE DB

Transcription factor

Q96N48

Zinc finger protein 746

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 242 aa

34 Generated PWM 8 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)26
MotifPredictionSourceDNA bindingSupportLogoActions
M06068_2.00 NN 70-40% CisBP GGGAATCCCCT 53.3% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 52.5% identity Open · Scan
M04590_2.00 NN 70-40% CisBP TGCGCTAACCATTGC 51.9% identity Open · Scan
M07593_2.00 NN 70-40% CisBP AGATGAAGTCACCCCTCTTAC 51.9% identity Open · Scan
M06135_2.00 NN 70-40% CisBP CAGCCACGCCCACCT 51.8% identity Open · Scan
M07600_2.00 NN 70-40% CisBP GCATTAGC 51.8% identity Open · Scan
M08334_2.00 NN 70-40% CisBP TTTGTTTTTTTCTGATTGCTTTTTACTTAT 51.8% identity Open · Scan
M08985_2.00 NN 70-40% CisBP TGAGGACCTACTGTGTGCC 51.8% identity Open · Scan
MA1656.1 NN 70-40% JASPAR CCAAGCCCAACCAG 51.8% identity Open · Scan
M00647_2.00 NN 70-40% CisBP CCCCCCC 51.7% identity Open · Scan
M02903_2.00 NN 70-40% CisBP ATGCCACGCCCCTTTTTG 51.6% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 51.2% identity Open · Scan
M00950_2.00 NN 70-40% CisBP GCAGCCCA 51.2% identity Open · Scan
M08311_2.00 NN 70-40% CisBP CTGGAACAGAAGGGGCGA 51.2% identity Open · Scan
M07625_2.00 NN 70-40% CisBP TCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 50.9% identity Open · Scan
M07700_2.00 NN 70-40% CisBP ATGTTGTGAGGAAGCCCA 50.6% identity Open · Scan
M00953_2.00 NN 70-40% CisBP ATCTATAT 50.0% identity Open · Scan
M00959_2.00 NN 70-40% CisBP GCCCTCCC 50.0% identity Open · Scan
M01470_2.00 NN 70-40% CisBP CCCCCCGC 50.0% identity Open · Scan
M02924_2.00 NN 70-40% CisBP AGTGTTAACAGAACACCT 50.0% identity Open · Scan
M03682_2.00 NN 70-40% CisBP ACGCCACGCCCAGT 50.0% identity Open · Scan
M07727_2.00 NN 70-40% CisBP CGCCGCCTCCCC 50.0% identity Open · Scan
MA0079.1 NN 70-40% JASPAR GGGGCGGGGT 50.0% identity Open · Scan
MA0695.1 NN 70-40% JASPAR GCGACCACCGAA 50.0% identity Open · Scan
MA1596.1 NN 70-40% JASPAR GCCTCAGCCTCCCGAG 50.0% identity Open · Scan
MA1602.1 NN 70-40% JASPAR CGTCTACACGGG 50.0% identity Open · Scan
ModCRE8
MotifPredictionSourceDNA bindingSupportLogoActions
DIMER_tr_Q96N48_Q96N48_HUMAN:182:231_1llm_C_1 ModCRE Homology model GCCCGCCGCGAC Region 182-231 · 1 3D model Open · Scan
DIMER_tr_Q96N48_Q96N48_HUMAN:211:230_1hwt_C_1 ModCRE Homology model AAGCCCCTAAATTTACG Region 211-230 · 1 3D model Open · Scan
DIMER_tr_Q96N48_Q96N48_HUMAN:211:230_2hap_D_1 ModCRE Homology model CAGTCCCTAAATAATAT Region 211-230 · 1 3D model Open · Scan
TFS_tr_Q96N48_Q96N48_HUMAN:158:234_5ei9_E_1 ModCRE Homology model GGGGCCCCCCCCCGGGG Region 158-234 · 1 3D model Open · Scan
TFS_tr_Q96N48_Q96N48_HUMAN:78:234_5wjq_D_1 ModCRE Homology model GCCCGGTAAAAGTTTTCGCCCCGC Region 78-234 · 1 3D model Open · Scan
TFS_tr_Q96N48_Q96N48_HUMAN:80:234_2i13_A_1 ModCRE Homology model GGTCGCGGAACGCCGGTATTT Region 80-234 · 1 3D model Open · Scan
TFS_tr_Q96N48_Q96N48_HUMAN:86:234_5v3j_E_1 ModCRE Homology model GACGGACGTCCCAGCCCGCGGGTA Region 86-234 · 1 3D model Open · Scan
TFS_tr_Q96N48_Q96N48_HUMAN:86:234_5v3m_C_1 ModCRE Homology model TGGGGTCTCTTTACCCCCCCCCA Region 86-234 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 242 aa
78-234

Region 78-234 8 PWM

Residues
157 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
8 active PDBs · 8 summary rows
Templates
1HWT, 1LLM, 2HAP, 2I13, 5EI9, 5V3J, 5V3M, 5WJQ
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
8 active PDB models 8 summary rows
Region 78-2348 models · 8 summary rows
Actions
Predicted = Low DIMER_tr_Q96N48_Q96N48_HUMAN:182:231_1llm_C_1 1llm 182-231 View model · PDB
Predicted = Low DIMER_tr_Q96N48_Q96N48_HUMAN:211:230_1hwt_C_1 1hwt 211-230 View model · PDB
Predicted = Low DIMER_tr_Q96N48_Q96N48_HUMAN:211:230_2hap_D_1 2hap 211-230 View model · PDB
Predicted = Low TFS_tr_Q96N48_Q96N48_HUMAN:158:234_5ei9_E_1 5ei9 158-234 View model · PDB
Predicted = Low TFS_tr_Q96N48_Q96N48_HUMAN:78:234_5wjq_D_1 5wjq 78-234 View model · PDB
Predicted = Low TFS_tr_Q96N48_Q96N48_HUMAN:80:234_2i13_A_1 2i13 80-234 View model · PDB
Predicted = Low TFS_tr_Q96N48_Q96N48_HUMAN:86:234_5v3j_E_1 5v3j 86-234 View model · PDB
Predicted = Low TFS_tr_Q96N48_Q96N48_HUMAN:86:234_5v3m_C_1 5v3m 86-234 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
5 5ei9 78:242 158 234 P:E · DNA:A,B 50.6% / 67.5% 69 View · PDB TFS_tr_Q96N48_Q96N48_HUMAN:158:234_5ei9_E_1
2 1hwt 78:242 211,211 230,230 P:C,D · DNA:A,B 45.0% / 65.0% 28,27 View · PDB DIMER_tr_Q96N48_Q96N48_HUMAN:211:230_1hwt_C_1
3 2hap 78:242 211,211 230,230 P:C,D · DNA:A,B 45.0% / 60.0% 26,26 View · PDB DIMER_tr_Q96N48_Q96N48_HUMAN:211:230_2hap_D_1
1 1llm 78:242 182,182 231,231 P:C,D · DNA:A,B 42.0% / 60.0% 57,58 View · PDB DIMER_tr_Q96N48_Q96N48_HUMAN:182:231_1llm_C_1
1 2i13 78:242 80 234 P:A · DNA:C,D 37.8% / 48.7% 99 View · PDB TFS_tr_Q96N48_Q96N48_HUMAN:80:234_2i13_A_1
2 5v3m 78:242 86 234 P:C · DNA:A,B 35.6% / 46.3% 53 View · PDB TFS_tr_Q96N48_Q96N48_HUMAN:86:234_5v3m_C_1
3 5v3j 78:242 86 234 P:E · DNA:A,B 35.6% / 46.3% 53 View · PDB TFS_tr_Q96N48_Q96N48_HUMAN:86:234_5v3j_E_1
4 5wjq 78:242 78 234 P:D · DNA:A,B 35.0% / 47.8% 55 View · PDB TFS_tr_Q96N48_Q96N48_HUMAN:78:234_5wjq_D_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
99-120PF00096Zinc finger, C2H2 typeoverlaps 78-234
157-178PF00096Zinc finger, C2H2 typeoverlaps 78-234
184-206PF00096Zinc finger, C2H2 typeoverlaps 78-234
212-234PF00096Zinc finger, C2H2 typeoverlaps 78-234