Transcription factor

Q96NI8 - ZNF570

Zinc finger protein 570

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 536 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
M07635_2.00	Known	CisBP	AAGTTTTCTTGTATTATATCT	Direct PWM		Open · Scan

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 536 aa

243-520

Residues: 278 aa
Domains: PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models: 1 active PDB
Templates: 5WJQ
Sources: Structure model

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 243-5201 model

				Actions
Predicted = Low	TFS_Q96NI8:243:520_5wjq_D_1	5wjq	243-520	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
13-54	PF01352	KRAB box	No overlap with loaded model regions
219-240	PF00096	Zinc finger, C2H2 type	No overlap with loaded model regions
246-268	PF00096	Zinc finger, C2H2 type	overlaps 243-520
274-296	PF00096	Zinc finger, C2H2 type	overlaps 243-520
302-324	PF00096	Zinc finger, C2H2 type	overlaps 243-520
330-352	PF00096	Zinc finger, C2H2 type	overlaps 243-520
358-380	PF00096	Zinc finger, C2H2 type	overlaps 243-520
386-408	PF00096	Zinc finger, C2H2 type	overlaps 243-520
414-436	PF00096	Zinc finger, C2H2 type	overlaps 243-520
442-464	PF00096	Zinc finger, C2H2 type	overlaps 243-520
470-492	PF00096	Zinc finger, C2H2 type	overlaps 243-520
498-520	PF00096	Zinc finger, C2H2 type	overlaps 243-520