Transcription factor

Q96SQ5 - ZNF587

Zinc finger protein 587

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 575 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
M07746_2.00	Known	CisBP	CAGCTGGCGCCCAACATGGGTCCC	Direct PWM		Open · Scan

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 575 aa

267-543

Residues: 277 aa
Domains: PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models: 1 active PDB
Templates: 5WJQ
Sources: Structure model

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 267-5431 model

				Actions
Predicted = Low	TFS_Q96SQ5:267:543_5wjq_D_1	5wjq	267-543	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
15-55	PF01352	KRAB box	No overlap with loaded model regions
240-262	PF00096	Zinc finger, C2H2 type	No overlap with loaded model regions
268-290	PF00096	Zinc finger, C2H2 type	overlaps 267-543
296-318	PF00096	Zinc finger, C2H2 type	overlaps 267-543
324-346	PF00096	Zinc finger, C2H2 type	overlaps 267-543
352-374	PF00096	Zinc finger, C2H2 type	overlaps 267-543
380-402	PF00096	Zinc finger, C2H2 type	overlaps 267-543
408-430	PF00096	Zinc finger, C2H2 type	overlaps 267-543
436-458	PF00096	Zinc finger, C2H2 type	overlaps 267-543
464-486	PF00096	Zinc finger, C2H2 type	overlaps 267-543
492-514	PF00096	Zinc finger, C2H2 type	overlaps 267-543
520-542	PF00096	Zinc finger, C2H2 type	overlaps 267-543
548-570	PF00096	Zinc finger, C2H2 type	No overlap with loaded model regions