Transcription factor

Q99593 - TBX5

T-box transcription factor TBX5 (T-box protein 5)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 518 aa

3 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known3

Motif	Prediction	Source	DNA binding	Support	Actions
MA0807.1	Known	JASPAR	AGGTGTGA	Direct PWM	Open · Scan
M03552_2.00	Known	CisBP	AGGTGTGA	Direct PWM	Open · Scan
M03553_2.00	Known	CisBP	AGGTGTGAAATTTCACACCT	Direct PWM	Open · Scan

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 518 aa

53-238

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 53-2381 model

				Actions
Predicted = Low	DIMER_Q99593:53:238_4s0h_E_1	4s0h	53-238	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
57-237	PF00907	T-box	overlaps 53-238