ModCRE DB

Transcription factor

Q99853 - FOXB1

Forkhead box protein B1 (Transcription factor FKH-5)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 325 aa

7 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known7
MotifPredictionSourceDNA bindingSupportLogoActions
MA0845.1 Known JASPAR TATGTAAATAT Direct PWM Open · Scan
M03028_2.00 Known CisBP GAATGACACAGCGA Direct PWM Open · Scan
M03029_2.00 Known CisBP TATGTCAATATTTACATA Direct PWM Open · Scan
M03030_2.00 Known CisBP ATATTTACATA Direct PWM Open · Scan
M03031_2.00 Known CisBP TTGTTTACA Direct PWM Open · Scan
M04837_2.00 Known CisBP TTATGTAAATATTGACATAA Direct PWM Open · Scan
M04838_2.00 Known CisBP TTATGTAAATATTGACATAA Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 325 aa
12-92

Region 12-92 0 PWM

Residues
81 aa
Domains
PF00250 · Forkhead domain
3D models
1 active PDB
Templates
3G73
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 12-921 model
Actions
Predicted = Low DIMER_Q99853:12:92_3g73_A_1 3g73 12-92 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
12-98PF00250Forkhead domainoverlaps 12-92