ModCRE DB

Transcription factor

Q9C0G0 - ZNF407

Zinc finger protein 407

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 2248 aa

12 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)6
MotifPredictionSourceDNA bindingSupportLogoActions
M00960_2.00 NN 70-40% CisBP TGCATCCC 51.7% identity Open · Scan
M00948_2.00 NN 70-40% CisBP GCAGCACC 50.5% identity Open · Scan
M00950_2.00 NN 70-40% CisBP GCAGCCCA 50.5% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 50.5% identity Open · Scan
M00143_2.00 NN 70-40% CisBP CCCCCCCACG 50.0% identity Open · Scan
MA0753.1 NN 70-40% JASPAR CCCCCCCCAC 50.0% identity Open · Scan
ModCRE6
MotifPredictionSourceDNA bindingSupportLogoActions
DIMER_sp_Q9C0G0_ZN407_HUMAN:1712:1760_1llm_C_1 ModCRE Homology model CCCGCCGCGGGG Region 1712-1760 · 1 3D model Open · Scan
TFS_sp_Q9C0G0_ZN407_HUMAN:1486:1747_5wjq_D_1 ModCRE Homology model TGGCCCCCCGCGGTCCCGGAGGCCCTT Region 1486-1747 · 1 3D model Open · Scan
TFS_sp_Q9C0G0_ZN407_HUMAN:1615:1796_8sss_A_1 ModCRE Homology model ACCAGCGGCCCCCCCAGGGTCTA Region 1615-1796 · 1 3D model Open · Scan
TFS_sp_Q9C0G0_ZN407_HUMAN:1615:1796_8sst_A_1 ModCRE Homology model ACCAGCAGGGCCCCCAGGCCAAC Region 1615-1796 · 1 3D model Open · Scan
TFS_sp_Q9C0G0_ZN407_HUMAN:1615:1800_7w1m_H_1 ModCRE Homology model GCTGGGGCTGGGGTACCCGCCGCCGCCA Region 1615-1800 · 1 3D model Open · Scan
TFS_sp_Q9C0G0_ZN407_HUMAN:1630:1796_5t0u_A_1 ModCRE Homology model ACCAGCAGGCCCCCCAGGCCCCA Region 1630-1796 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 2248 aa
1486-1800

Region 1486-1800 6 PWM

Residues
315 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
6 active PDBs · 6 summary rows
Templates
1LLM, 5T0U, 5WJQ, 7W1M, 8SSS, 8SST
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models 6 summary rows
Region 1486-18006 models · 6 summary rows
Actions
Predicted = Low DIMER_sp_Q9C0G0_ZN407_HUMAN:1712:1760_1llm_C_1 1llm 1712-1760 View model · PDB
Predicted = Low TFS_sp_Q9C0G0_ZN407_HUMAN:1486:1747_5wjq_D_1 5wjq 1486-1747 View model · PDB
Predicted = Low TFS_sp_Q9C0G0_ZN407_HUMAN:1615:1796_8sss_A_1 8sss 1615-1796 View model · PDB
Predicted = Low TFS_sp_Q9C0G0_ZN407_HUMAN:1615:1796_8sst_A_1 8sst 1615-1796 View model · PDB
Predicted = Low TFS_sp_Q9C0G0_ZN407_HUMAN:1615:1800_7w1m_H_1 7w1m 1615-1800 View model · PDB
Predicted = Low TFS_sp_Q9C0G0_ZN407_HUMAN:1630:1796_5t0u_A_1 5t0u 1630-1796 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
5 5t0u 1486:1851 1630 1796 P:A · DNA:B,C 40.5% / 54.2% 96 View · PDB TFS_sp_Q9C0G0_ZN407_HUMAN:1630:1796_5t0u_A_1
4 7w1m 1486:1851 1615 1800 P:H · DNA:F,G 39.6% / 52.4% 56 View · PDB TFS_sp_Q9C0G0_ZN407_HUMAN:1615:1800_7w1m_H_1
2 8sst 1486:1851 1615 1796 P:A · DNA:B,C 39.3% / 52.5% 90 View · PDB TFS_sp_Q9C0G0_ZN407_HUMAN:1615:1796_8sst_A_1
3 8sss 1486:1851 1615 1796 P:A · DNA:B,C 39.3% / 52.5% 90 View · PDB TFS_sp_Q9C0G0_ZN407_HUMAN:1615:1796_8sss_A_1
1 1llm 1486:1851 1712,1712 1760,1760 P:C,D · DNA:A,B 38.8% / 55.1% 56,57 View · PDB DIMER_sp_Q9C0G0_ZN407_HUMAN:1712:1760_1llm_C_1
1 5wjq 1486:1851 1486 1747 P:D · DNA:A,B 32.6% / 47.9% 90 View · PDB TFS_sp_Q9C0G0_ZN407_HUMAN:1486:1747_5wjq_D_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
1628-1650PF00096Zinc finger, C2H2 typeoverlaps 1486-1800
1714-1736PF00096Zinc finger, C2H2 typeoverlaps 1486-1800