ModCRE DB

Transcription factor

Q9H2P0 - ADNP

Activity-dependent neuroprotector homeobox protein (Activity-dependent neuroprotective protein)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 1102 aa

11 Generated PWM 11 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE11
MotifPredictionSourceDNA bindingSupportLogoActions
DIMER_sp_Q9H2P0_ADNP_HUMAN:771:809_3d1n_L_1 ModCRE Homology model GTAAACAGTTTGGA Region 771-809 · 1 3D model Open · Scan
DIMER_sp_Q9H2P0_ADNP_HUMAN:771:810_1du0_A_1 ModCRE Homology model CCCCAGGAGGGCCCAC Region 771-810 · 1 3D model Open · Scan
DIMER_sp_Q9H2P0_ADNP_HUMAN:771:810_1hdd_D_1 ModCRE Homology model GCCCAGACGGGCCCCC Region 771-810 · 1 3D model Open · Scan
DIMER_sp_Q9H2P0_ADNP_HUMAN:771:810_2hdd_A_1 ModCRE Homology model CGCCAGGGGGGCGGGT Region 771-810 · 1 3D model Open · Scan
DIMER_sp_Q9H2P0_ADNP_HUMAN:771:810_3hdd_A_1 ModCRE Homology model GCCCAGGGGGGGGCCC Region 771-810 · 1 3D model Open · Scan
DIMER_sp_Q9H2P0_ADNP_HUMAN:771:810_3l1p_A_1 ModCRE Homology model CCTGTTTAGAAACGAAACAGGG Region 771-810 · 1 3D model Open · Scan
TFS_sp_Q9H2P0_ADNP_HUMAN:439:473_6dfa_A_1 ModCRE Homology model AGTGCCGAGGCA Region 439-473 · 1 3D model Open · Scan
TFS_sp_Q9H2P0_ADNP_HUMAN:76:100_4f6m_A_1 ModCRE Homology model GTTTTCCGGCCC Region 76-100 · 1 3D model Open · Scan
TFS_sp_Q9H2P0_ADNP_HUMAN:76:100_4f6n_A_1 ModCRE Homology model GTTTTGACCC Region 76-100 · 1 3D model Open · Scan
TFS_sp_Q9H2P0_ADNP_HUMAN:76:100_6df5_A_1 ModCRE Homology model TTCTTTTCGCC Region 76-100 · 1 3D model Open · Scan
TFS_sp_Q9H2P0_ADNP_HUMAN:76:100_6v8u_A_1 ModCRE Homology model TTTTACGTTA Region 76-100 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 1102 aa
76-100
439-473
771-810

Region 76-100 4 PWM

Residues
25 aa
Domains
PF19627 · Activity-dependent neuroprotector homeobox protein N-terminal
3D models
4 active PDBs · 4 summary rows
Templates
4F6M, 4F6N, 6DF5, 6V8U
Sources
Predicted = Low
Scan this region Show models

Region 439-473 1 PWM

Residues
35 aa
Domains
PF26748 · Adnp2-like, C2H2-type zinc finger
3D models
1 active PDB · 1 summary row
Templates
6DFA
Sources
Predicted = Low
Scan this region Show models

Region 771-810 6 PWM

Residues
40 aa
Domains
PF00046 · Homeodomain
3D models
6 active PDBs · 5 summary rows
Templates
1DU0, 1HDD, 2HDD, 3D1N, 3HDD, 3L1P
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
11 active PDB models 10 summary rows
Region 76-1004 models · 4 summary rows
Actions
Predicted = Low TFS_sp_Q9H2P0_ADNP_HUMAN:76:100_4f6m_A_1 4f6m 76-100 View model · PDB
Predicted = Low TFS_sp_Q9H2P0_ADNP_HUMAN:76:100_4f6n_A_1 4f6n 76-100 View model · PDB
Predicted = Low TFS_sp_Q9H2P0_ADNP_HUMAN:76:100_6df5_A_1 6df5 76-100 View model · PDB
Predicted = Low TFS_sp_Q9H2P0_ADNP_HUMAN:76:100_6v8u_A_1 6v8u 76-100 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
2 6v8u 439:473 76 100 P:A · DNA:D,E 40.0% / 56.0% 20 View · PDB TFS_sp_Q9H2P0_ADNP_HUMAN:76:100_6v8u_A_1
3 4f6n 439:473 76 100 P:A · DNA:D,E 40.0% / 56.0% 20 View · PDB TFS_sp_Q9H2P0_ADNP_HUMAN:76:100_4f6n_A_1
4 6df5 439:473 76 100 P:A · DNA:D,E 40.0% / 56.0% 21 View · PDB TFS_sp_Q9H2P0_ADNP_HUMAN:76:100_6df5_A_1
5 4f6m 439:473 76 100 P:A · DNA:D,E 40.0% / 56.0% 21 View · PDB TFS_sp_Q9H2P0_ADNP_HUMAN:76:100_4f6m_A_1
Region 439-4731 model · 1 summary row
Actions
Predicted = Low TFS_sp_Q9H2P0_ADNP_HUMAN:439:473_6dfa_A_1 6dfa 439-473 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 6dfa 439:473 439 473 P:A · DNA:D,E 31.4% / 42.9% 29 View · PDB TFS_sp_Q9H2P0_ADNP_HUMAN:439:473_6dfa_A_1
Region 771-8106 models · 5 summary rows
Actions
Predicted = Low DIMER_sp_Q9H2P0_ADNP_HUMAN:771:809_3d1n_L_1 3d1n 771-809 View model · PDB
Predicted = Low DIMER_sp_Q9H2P0_ADNP_HUMAN:771:810_1du0_A_1 1du0 771-810 View model · PDB
Predicted = Low DIMER_sp_Q9H2P0_ADNP_HUMAN:771:810_1hdd_D_1 1hdd 771-810 View model · PDB
Predicted = Low DIMER_sp_Q9H2P0_ADNP_HUMAN:771:810_2hdd_A_1 2hdd 771-810 View model · PDB
Predicted = Low DIMER_sp_Q9H2P0_ADNP_HUMAN:771:810_3hdd_A_1 3hdd 771-810 View model · PDB
Predicted = Low DIMER_sp_Q9H2P0_ADNP_HUMAN:771:810_3l1p_A_1 3l1p 771-810 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 3d1n 439:473 771,771 809,809 P:K,L · DNA:C,D 38.5% / 56.4% 26,26 View · PDB DIMER_sp_Q9H2P0_ADNP_HUMAN:771:809_3d1n_L_1
2 1du0 439:473 771,771 810,810 P:A,B · DNA:C,D 37.5% / 60.0% 75,71 View · PIR DIMER_sp_Q9H2P0_ADNP_HUMAN:771:810_1du0_A_1
3 3hdd 439:473 771,771 810,810 P:A,B · DNA:C,D 37.5% / 57.5% 72,71 View · PDB DIMER_sp_Q9H2P0_ADNP_HUMAN:771:810_3hdd_A_1
4 2hdd 439:473 771,771 810,810 P:A,B · DNA:C,D 37.5% / 57.5% 72,71 View · PIR DIMER_sp_Q9H2P0_ADNP_HUMAN:771:810_2hdd_A_1
5 1hdd 439:473 771,771 810,810 P:C,D · DNA:A,B 37.5% / 57.5% 70,70 View · PDB DIMER_sp_Q9H2P0_ADNP_HUMAN:771:810_1hdd_D_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
2-130PF19627Activity-dependent neuroprotector homeobox protein N-terminaloverlaps 76-100
446-470PF26748Adnp2-like, C2H2-type zinc fingeroverlaps 439-473
769-810PF00046Homeodomainoverlaps 771-810