Region 463-705 4 PWM
- Residues
- 243 aa
- Domains
- PF13912 · C2H2-type zinc finger PF00096 · Zinc finger, C2H2 type
- 3D models
- 5 active PDBs · 5 summary rows
- Templates
- 5V3J, 5V3M, 5WJQ, 7W1M, 8SSU
- Sources
- Predicted = Low
Transcription factor
Q9H4Z2 - ZNF335
Zinc finger protein 335 (NRC-interacting factor 1) (NIF-1)
Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 1342 aa
Motif Prediction
Only entries with a generated matrix are shown here.
Known2
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| M08952_2.00 | Known | CisBP | GGCTGTCCTCGGCGCTGCCTGA | Direct PWM | Open · Scan | |
| ZN335_HUMAN.H11MO.0.A | Known | HOCOMOCO | GGCTGTCCTCGGCGCTGCCTGA | Direct PWM | Open · Scan |
Nearest Neighbor (>70%)0
No generated PWM in this category.
Nearest Neighbor (70% - 40%)3
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| M01849_2.00 | NN 70-40% | CisBP | ACTAATTAG | 54.1% identity | Open · Scan | |
| M01199_2.00 | NN 70-40% | CisBP | GCGCCACC | 53.8% identity | Open · Scan | |
| M06135_2.00 | NN 70-40% | CisBP | CAGCCACGCCCACCT | 50.0% identity | Open · Scan |
ModCRE4
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| TFS_sp_Q9H4Z2_ZN335_HUMAN:463:698_5wjq_D_1 | ModCRE | Homology model | GCGCACCGGGGCGTGTCCGGGGGG | Region 463-698 · 1 3D model | Open · Scan | |
| TFS_sp_Q9H4Z2_ZN335_HUMAN:463:705_8ssu_A_1 | ModCRE | Homology model | GACACCGCGTTCTGTGGCC | Region 463-705 · 1 3D model | Open · Scan | |
| TFS_sp_Q9H4Z2_ZN335_HUMAN:496:698_5v3j_E_1 | ModCRE | Homology model | ACGGGGAAAATTTTGCTT | Region 496-698 · 1 3D model | Open · Scan | |
| TFS_sp_Q9H4Z2_ZN335_HUMAN:496:698_5v3m_C_1 | ModCRE | Homology model | CGAGGGAAATCATTGGTAG | Region 496-698 · 1 3D model | Open · Scan |
Model-supported DNA-binding regions
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
1
1342 aa
463-705
1072-1121
Region 1072-1121 0 PWM
- Residues
- 50 aa
- Domains
- PF13909 · C2H2-type zinc-finger domain
- 3D models
- 1 active PDB · 1 summary row
- Templates
- 1LLM
- Sources
- Predicted = Low
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models
6 summary rows
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
Region 463-7055 models · 5 summary rows
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | TFS_sp_Q9H4Z2_ZN335_HUMAN:463:698_5wjq_D_1 | 5wjq | 463-698 | View model · PDB |
| Predicted = Low | TFS_sp_Q9H4Z2_ZN335_HUMAN:463:705_7w1m_H_1 | 7w1m | 463-705 | View model · PDB |
| Predicted = Low | TFS_sp_Q9H4Z2_ZN335_HUMAN:463:705_8ssu_A_1 | 8ssu | 463-705 | View model · PDB |
| Predicted = Low | TFS_sp_Q9H4Z2_ZN335_HUMAN:496:698_5v3j_E_1 | 5v3j | 496-698 | View model · PDB |
| Predicted = Low | TFS_sp_Q9H4Z2_ZN335_HUMAN:496:698_5v3m_C_1 | 5v3m | 496-698 | View model · PDB |
Model-summary evidence imported for this region.
| Rank | Template | Domain | N-tails | C-tails | Chains | Identity / similarity | Coverage | Model file |
|---|---|---|---|---|---|---|---|---|
| 2 | 5v3m | 463:705 | 496 | 698 | P:C · DNA:A,B | 35.0% / 46.3% | 67 | View · PDB TFS_sp_Q9H4Z2_ZN335_HUMAN:496:698_5v3m_C_1 |
| 3 | 5v3j | 463:705 | 496 | 698 | P:E · DNA:A,B | 35.0% / 46.3% | 67 | View · PDB TFS_sp_Q9H4Z2_ZN335_HUMAN:496:698_5v3j_E_1 |
| 4 | 5wjq | 463:705 | 463 | 698 | P:D · DNA:A,B | 30.9% / 41.1% | 78 | View · PDB TFS_sp_Q9H4Z2_ZN335_HUMAN:463:698_5wjq_D_1 |
| 1 | 7w1m | 463:705 | 463 | 705 | P:H · DNA:F,G | 28.6% / 45.3% | 71 | View · PDB TFS_sp_Q9H4Z2_ZN335_HUMAN:463:705_7w1m_H_1 |
| 5 | 8ssu | 463:705 | 463 | 705 | P:A · DNA:B,C | 28.6% / 45.3% | 98 | View · PDB TFS_sp_Q9H4Z2_ZN335_HUMAN:463:705_8ssu_A_1 |
Region 1072-11211 model · 1 summary row
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | DIMER_sp_Q9H4Z2_ZN335_HUMAN:1072:1121_1llm_D_1 | 1llm | 1072-1121 | View model · PDB |
Model-summary evidence imported for this region.
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Domains
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 562-585 | PF13912 | C2H2-type zinc finger | overlaps 463-705 |
| 590-612 | PF00096 | Zinc finger, C2H2 type | overlaps 463-705 |
| 1076-1099 | PF13909 | C2H2-type zinc-finger domain | overlaps 1072-1121 |