ModCRE DB

Transcription factor

Q9H582 - ZNF644

Zinc finger protein 644 (Zinc finger motif enhancer-binding protein 2) (Zep-2)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 1327 aa

7 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M04505_2.00 NN 70-40% CisBP AGCTTTTCCCACAC 51.8% identity Open · Scan
ModCRE6
MotifPredictionSourceDNA bindingSupportLogoActions
DIMER_sp_Q9H582_ZN644_HUMAN:497:548_1llm_C_1 ModCRE Homology model AGGCGGCGCGAA Region 497-548 · 1 3D model Open · Scan
TFS_sp_Q9H582_ZN644_HUMAN:410:480_5egb_A_1 ModCRE Homology model GGGGGCCCCAGTCTTT Region 410-480 · 1 3D model Open · Scan
TFS_sp_Q9H582_ZN644_HUMAN:410:480_5eh2_F_1 ModCRE Homology model AGGGCCCCCGGGTCT Region 410-480 · 1 3D model Open · Scan
TFS_sp_Q9H582_ZN644_HUMAN:410:480_5ei9_E_1 ModCRE Homology model ATGGACCGGGGGCCC Region 410-480 · 1 3D model Open · Scan
TFS_sp_Q9H582_ZN644_HUMAN:438:564_2i13_A_1 ModCRE Homology model GTCCGGGCCGTGCTCCGAAAA Region 438-564 · 1 3D model Open · Scan
TFS_sp_Q9H582_ZN644_HUMAN:446:473_4m9v_C_1 ModCRE Homology model GCGGCGTAGC Region 446-473 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 1327 aa
410-564

Region 410-564 6 PWM

Residues
155 aa
Domains
PF00096 · Zinc finger, C2H2 type
3D models
6 active PDBs · 6 summary rows
Templates
1LLM, 2I13, 4M9V, 5EGB, 5EH2, 5EI9
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models 6 summary rows
Region 410-5646 models · 6 summary rows
Actions
Predicted = Low DIMER_sp_Q9H582_ZN644_HUMAN:497:548_1llm_C_1 1llm 497-548 View model · PDB
Predicted = Low TFS_sp_Q9H582_ZN644_HUMAN:410:480_5egb_A_1 5egb 410-480 View model · PDB
Predicted = Low TFS_sp_Q9H582_ZN644_HUMAN:410:480_5eh2_F_1 5eh2 410-480 View model · PDB
Predicted = Low TFS_sp_Q9H582_ZN644_HUMAN:410:480_5ei9_E_1 5ei9 410-480 View model · PDB
Predicted = Low TFS_sp_Q9H582_ZN644_HUMAN:438:564_2i13_A_1 2i13 438-564 View model · PDB
Predicted = Low TFS_sp_Q9H582_ZN644_HUMAN:446:473_4m9v_C_1 4m9v 446-473 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
5 4m9v 410:480 446 473 P:C · DNA:A,B 42.9% / 75.0% 47 View · PDB TFS_sp_Q9H582_ZN644_HUMAN:446:473_4m9v_C_1
1 5ei9 410:480 410 480 P:E · DNA:A,B 38.0% / 49.3% 54 View · PDB TFS_sp_Q9H582_ZN644_HUMAN:410:480_5ei9_E_1
2 5egb 410:480 410 480 P:A · DNA:C,D 38.0% / 49.3% 54 View · PDB TFS_sp_Q9H582_ZN644_HUMAN:410:480_5egb_A_1
3 5eh2 410:480 410 480 P:F · DNA:C,D 38.0% / 49.3% 55 View · PDB TFS_sp_Q9H582_ZN644_HUMAN:410:480_5eh2_F_1
1 1llm 410:480 497,497 548,548 P:C,D · DNA:A,B 26.9% / 42.3% 58,60 View · PDB DIMER_sp_Q9H582_ZN644_HUMAN:497:548_1llm_C_1
4 2i13 410:480 438 564 P:A · DNA:C,D 25.9% / 41.5% 82 View · PDB TFS_sp_Q9H582_ZN644_HUMAN:438:564_2i13_A_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
448-470PF00096Zinc finger, C2H2 typeoverlaps 410-564
1257-1290PF23015Zinc finger found in WIZ proteinNo overlap with loaded model regions