ModCRE DB

Transcription factor

Q9H686

cDNA: FLJ22500 fis, clone HRC11301

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 347 aa

5 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE5
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_tr_Q9H686_Q9H686_HUMAN:224:347_5v3j_E_1 ModCRE Homology model ACGTCTTCGGGTCCTCTGGG Region 224-347 · 1 3D model Open · Scan
TFS_tr_Q9H686_Q9H686_HUMAN:224:347_5v3m_C_1 ModCRE Homology model GACTCCTCCCAGCCACCCTT Region 224-347 · 1 3D model Open · Scan
TFS_tr_Q9H686_Q9H686_HUMAN:227:342_5egb_A_1 ModCRE Homology model CGGGGGCAGGGGGGAGAG Region 227-342 · 1 3D model Open · Scan
TFS_tr_Q9H686_Q9H686_HUMAN:227:342_5ei9_E_1 ModCRE Homology model CACCCCCCCTCCCCCCC Region 227-342 · 1 3D model Open · Scan
TFS_tr_Q9H686_Q9H686_HUMAN:228:342_5eh2_F_1 ModCRE Homology model CGGGGGCAGGGGGGGCGGA Region 228-342 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 347 aa
224-347

Region 224-347 5 PWM

Residues
124 aa
Domains
PF00096 · Zinc finger, C2H2 type
3D models
6 active PDBs · 6 summary rows
Templates
1LLM, 5EGB, 5EH2, 5EI9, 5V3J, 5V3M
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models 6 summary rows
Region 224-3476 models · 6 summary rows
Actions
Predicted = Low DIMER_tr_Q9H686_Q9H686_HUMAN:290:339_1llm_D_1 1llm 290-339 View model · PDB
Predicted = Low TFS_tr_Q9H686_Q9H686_HUMAN:224:347_5v3j_E_1 5v3j 224-347 View model · PDB
Predicted = Low TFS_tr_Q9H686_Q9H686_HUMAN:224:347_5v3m_C_1 5v3m 224-347 View model · PDB
Predicted = Low TFS_tr_Q9H686_Q9H686_HUMAN:227:342_5egb_A_1 5egb 227-342 View model · PDB
Predicted = Low TFS_tr_Q9H686_Q9H686_HUMAN:227:342_5ei9_E_1 5ei9 227-342 View model · PDB
Predicted = Low TFS_tr_Q9H686_Q9H686_HUMAN:228:342_5eh2_F_1 5eh2 228-342 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 5ei9 217:347 227 342 P:E · DNA:A,B 37.9% / 50.9% 98 View · PDB TFS_tr_Q9H686_Q9H686_HUMAN:227:342_5ei9_E_1
2 5egb 217:347 227 342 P:A · DNA:C,D 37.9% / 50.9% 98 View · PDB TFS_tr_Q9H686_Q9H686_HUMAN:227:342_5egb_A_1
3 5eh2 217:347 228 342 P:F · DNA:C,D 37.4% / 50.4% 99 View · PDB TFS_tr_Q9H686_Q9H686_HUMAN:228:342_5eh2_F_1
4 5v3m 217:347 224 347 P:C · DNA:A,B 35.5% / 50.0% 42 View · PDB TFS_tr_Q9H686_Q9H686_HUMAN:224:347_5v3m_C_1
5 5v3j 217:347 224 347 P:E · DNA:A,B 35.5% / 50.0% 42 View · PDB TFS_tr_Q9H686_Q9H686_HUMAN:224:347_5v3j_E_1
1 1llm 217:347 290,290 339,339 P:C,D · DNA:A,B 32.0% / 48.0% 57,58 View · PDB DIMER_tr_Q9H686_Q9H686_HUMAN:290:339_1llm_D_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
292-314PF00096Zinc finger, C2H2 typeoverlaps 224-347