Region 146-277 2 PWM
- Residues
- 132 aa
- Domains
- No overlapping PFAM annotation recorded
- 3D models
- 8 active PDBs · 6 summary rows
- Templates
- 1LLM, 2I13, 5EGB, 5EH2, 5EI9, 5YEL, 6ML3, 6ML7
- Sources
- Predicted = Low
Transcription factor
Q9H740
cDNA: FLJ21420 fis, clone COL04105
Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 302 aa
Motif Prediction
Only entries with a generated matrix are shown here.
Known0
No generated PWM in this category.
Nearest Neighbor (>70%)0
No generated PWM in this category.
Nearest Neighbor (70% - 40%)1
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| M08332_2.00 | NN 70-40% | CisBP | TCTCTCCAGTGTGAATTCTCTGAT | 56.3% identity | Open · Scan |
ModCRE2
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| TFS_tr_Q9H740_Q9H740_HUMAN:146:275_2i13_A_1 | ModCRE | Homology model | TGTGGCCCAGGGGGTCATTTT | Region 146-275 · 1 3D model | Open · Scan | |
| TFS_tr_Q9H740_Q9H740_HUMAN:196:275_5yel_B_1 | ModCRE | Homology model | TTTAATTAAACCGGCACCTAAAT | Region 196-275 · 1 3D model | Open · Scan |
Model-supported DNA-binding regions
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
1
302 aa
146-277
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
8 active PDB models
6 summary rows
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
Region 146-2778 models · 6 summary rows
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | DIMER_tr_Q9H740_Q9H740_HUMAN:226:277_1llm_C_1 | 1llm | 226-277 | View model · PDB |
| Predicted = Low | TFS_tr_Q9H740_Q9H740_HUMAN:146:275_2i13_A_1 | 2i13 | 146-275 | View model · PDB |
| Predicted = Low | TFS_tr_Q9H740_Q9H740_HUMAN:177:275_5egb_A_1 | 5egb | 177-275 | View model · PDB |
| Predicted = Low | TFS_tr_Q9H740_Q9H740_HUMAN:177:275_5eh2_F_1 | 5eh2 | 177-275 | View model · PDB |
| Predicted = Low | TFS_tr_Q9H740_Q9H740_HUMAN:177:275_5ei9_E_1 | 5ei9 | 177-275 | View model · PDB |
| Predicted = Low | TFS_tr_Q9H740_Q9H740_HUMAN:196:272_6ml3_A_1 | 6ml3 | 196-272 | View model · PDB |
| Predicted = Low | TFS_tr_Q9H740_Q9H740_HUMAN:196:272_6ml7_A_1 | 6ml7 | 196-272 | View model · PDB |
| Predicted = Low | TFS_tr_Q9H740_Q9H740_HUMAN:196:275_5yel_B_1 | 5yel | 196-275 | View model · PDB |
Model-summary evidence imported for this region.
| Rank | Template | Domain | N-tails | C-tails | Chains | Identity / similarity | Coverage | Model file |
|---|---|---|---|---|---|---|---|---|
| 4 | 6ml3 | 139:300 | 196 | 272 | P:A · DNA:E,F | 36.4% / 50.6% | 65 | View · PDB TFS_tr_Q9H740_Q9H740_HUMAN:196:272_6ml3_A_1 |
| 5 | 6ml7 | 139:300 | 196 | 272 | P:A · DNA:E,F | 36.4% / 50.6% | 51 | View · PDB TFS_tr_Q9H740_Q9H740_HUMAN:196:272_6ml7_A_1 |
| 1 | 5ei9 | 139:300 | 177 | 275 | P:E · DNA:A,B | 34.3% / 46.5% | 84 | View · PDB TFS_tr_Q9H740_Q9H740_HUMAN:177:275_5ei9_E_1 |
| 2 | 5egb | 139:300 | 177 | 275 | P:A · DNA:C,D | 34.3% / 46.5% | 84 | View · PDB TFS_tr_Q9H740_Q9H740_HUMAN:177:275_5egb_A_1 |
| 3 | 5eh2 | 139:300 | 177 | 275 | P:F · DNA:C,D | 34.3% / 46.5% | 86 | View · PDB TFS_tr_Q9H740_Q9H740_HUMAN:177:275_5eh2_F_1 |
| 1 | 1llm | 139:300 | 226,226 | 277,277 | P:C,D · DNA:A,B | 25.0% / 46.2% | 57,58 | View · PDB DIMER_tr_Q9H740_Q9H740_HUMAN:226:277_1llm_C_1 |
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Domains
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 2-65 | PF13836 | Domain of unknown function (DUF4195) | No overlap with loaded model regions |