ModCRE DB

Transcription factor

Q9H9E2

cDNA FLJ12813 fis, clone NT2RP2002503, weakly similar to ZINC FINGER PROTEIN 45

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 538 aa

37 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)2
MotifPredictionSourceDNA bindingSupportLogoActions
M08399_2.00 NN 70+% CisBP TACTCTGGGGCCACATGACTC 76.7% identity Open · Scan
M07654_2.00 NN 70+% CisBP TGCCCCCTGGTGGC 70.8% identity Open · Scan
Nearest Neighbor (70% - 40%)35
MotifPredictionSourceDNA bindingSupportLogoActions
M07679_2.00 NN 70-40% CisBP TGCGATCTC 65.7% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 63.5% identity Open · Scan
M00953_2.00 NN 70-40% CisBP ATCTATAT 63.5% identity Open · Scan
M00955_2.00 NN 70-40% CisBP ACGTCCTCT 63.5% identity Open · Scan
M00960_2.00 NN 70-40% CisBP TGCATCCC 63.5% identity Open · Scan
M00948_2.00 NN 70-40% CisBP GCAGCACC 61.1% identity Open · Scan
M00950_2.00 NN 70-40% CisBP GCAGCCCA 61.1% identity Open · Scan
M00959_2.00 NN 70-40% CisBP GCCCTCCC 61.1% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 58.8% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 58.8% identity Open · Scan
M00958_2.00 NN 70-40% CisBP CGGCATCCC 58.8% identity Open · Scan
M01456_2.00 NN 70-40% CisBP GTGATCGGCG 56.5% identity Open · Scan
MA1124.1 NN 70-40% JASPAR CATTCATTCATTC 56.0% identity Open · Scan
M04387_2.00 NN 70-40% CisBP CGTGCTCCCC 55.8% identity Open · Scan
M04650_2.00 NN 70-40% CisBP GCATAACTGCCCCGCTGCC 55.6% identity Open · Scan
M01474_2.00 NN 70-40% CisBP CGCCGATCAC 55.1% identity Open · Scan
M08901_2.00 NN 70-40% CisBP CCAGTTCACACC 55.0% identity Open · Scan
M08314_2.00 NN 70-40% CisBP ATTCATCAAGGTCCTCAACAATGG 54.4% identity Open · Scan
M00939_2.00 NN 70-40% CisBP CCACCTCA 54.1% identity Open · Scan
M02924_2.00 NN 70-40% CisBP AGTGTTAACAGAACACCT 52.8% identity Open · Scan
M04613_2.00 NN 70-40% CisBP CTCATGTGCTAATTACAAA 52.8% identity Open · Scan
M00945_2.00 NN 70-40% CisBP CACCGCAC 51.7% identity Open · Scan
M08254_2.00 NN 70-40% CisBP CTGCCCTGGGACTTT 51.7% identity Open · Scan
M00786_2.00 NN 70-40% CisBP TATATATAT 51.3% identity Open · Scan
M04598_2.00 NN 70-40% CisBP CGCTAACTCTCCACA 51.3% identity Open · Scan
M07683_2.00 NN 70-40% CisBP GTGGGAAAGCCT 51.3% identity Open · Scan
MA1601.1 NN 70-40% JASPAR ATGTGGGAAA 51.3% identity Open · Scan
M07649_2.00 NN 70-40% CisBP CCCCCCCCCCCCTCAGGAATGCC 50.8% identity Open · Scan
M04505_2.00 NN 70-40% CisBP AGCTTTTCCCACAC 50.6% identity Open · Scan
M00782_2.00 NN 70-40% CisBP AGTGTGCGCTA 50.2% identity Open · Scan
M04536_2.00 NN 70-40% CisBP ACGTAACCCGATACC 50.2% identity Open · Scan
M06179_2.00 NN 70-40% CisBP TAAGCCTATAGA 50.0% identity Open · Scan
M08329_2.00 NN 70-40% CisBP GCTGCATAGTATTCC 50.0% identity Open · Scan
M08355_2.00 NN 70-40% CisBP GCGAACTCCTATTCATCC 50.0% identity Open · Scan
M08540_2.00 NN 70-40% CisBP CCCCT 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 538 aa
204-313

Region 204-313 0 PWM

Residues
110 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
6E93
Sources
Structure model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 204-3131 model
Actions
Predicted = Low TFS_Q9H9E2:204:313_6e93_A_1 6e93 204-313 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
8-48PF01352KRAB boxNo overlap with loaded model regions
176-198PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
204-226PF00096Zinc finger, C2H2 typeoverlaps 204-313
232-254PF00096Zinc finger, C2H2 typeoverlaps 204-313
260-282PF00096Zinc finger, C2H2 typeoverlaps 204-313
288-310PF00096Zinc finger, C2H2 typeoverlaps 204-313
372-394PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
400-422PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
428-450PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
456-478PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions