ModCRE DB

Transcription factor

Q9HAH1 - ZNF556

Zinc finger protein 556

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 456 aa

31 Generated PWM 10 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)22
MotifPredictionSourceDNA bindingSupportLogoActions
M00958_2.00 NN 70-40% CisBP CGGCATCCC 59.2% identity Open · Scan
M00939_2.00 NN 70-40% CisBP CCACCTCA 58.8% identity Open · Scan
M00950_2.00 NN 70-40% CisBP GCAGCCCA 58.0% identity Open · Scan
M00960_2.00 NN 70-40% CisBP TGCATCCC 58.0% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 57.6% identity Open · Scan
M04611_2.00 NN 70-40% CisBP CTTTCGGACAC 57.4% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 56.4% identity Open · Scan
M00959_2.00 NN 70-40% CisBP GCCCTCCC 55.5% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 55.2% identity Open · Scan
MA1124.1 NN 70-40% JASPAR CATTCATTCATTC 54.2% identity Open · Scan
M00948_2.00 NN 70-40% CisBP GCAGCACC 54.1% identity Open · Scan
M00953_2.00 NN 70-40% CisBP ATCTATAT 54.1% identity Open · Scan
M00945_2.00 NN 70-40% CisBP CACCGCAC 52.8% identity Open · Scan
M00955_2.00 NN 70-40% CisBP ACGTCCTCT 51.7% identity Open · Scan
M00645_2.00 NN 70-40% CisBP CGCCCACGCA 51.6% identity Open · Scan
M07762_2.00 NN 70-40% CisBP GCCGCGCACAGGCTTCTAGCC 51.5% identity Open · Scan
M08917_2.00 NN 70-40% CisBP GCTGAGCCATGTGGGGTGCT 51.5% identity Open · Scan
M00764_2.00 NN 70-40% CisBP GTCTACAC 51.4% identity Open · Scan
M08935_2.00 NN 70-40% CisBP CCTCCTCCCTCAGACC 51.3% identity Open · Scan
M04465_2.00 NN 70-40% CisBP GTGATTCTTATCTTATCCTT 50.0% identity Open · Scan
M07733_2.00 NN 70-40% CisBP TCTTTCTCTCTCTCC 50.0% identity Open · Scan
M08254_2.00 NN 70-40% CisBP CTGCCCTGGGACTTT 50.0% identity Open · Scan
ModCRE9
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_sp_Q9HAH1_ZN556_HUMAN:143:405_5wjq_D_1 ModCRE Homology model CCCCCCCCCCGCGGGGGCACGGGGCCGG Region 143-405 · 1 3D model Open · Scan
TFS_sp_Q9HAH1_ZN556_HUMAN:147:253_5egb_A_1 ModCRE Homology model CGGGGCCCGGGGACGGGA Region 147-253 · 1 3D model Open · Scan
TFS_sp_Q9HAH1_ZN556_HUMAN:147:253_5eh2_F_1 ModCRE Homology model GGGGGGGGGGGCTGGCGGG Region 147-253 · 1 3D model Open · Scan
TFS_sp_Q9HAH1_ZN556_HUMAN:147:253_5ei9_E_1 ModCRE Homology model CGGGCGGGCGGGGGGCG Region 147-253 · 1 3D model Open · Scan
TFS_sp_Q9HAH1_ZN556_HUMAN:147:408_5v3j_E_1 ModCRE Homology model TCCCCCCGGTGGGTAGCCCACTTC Region 147-408 · 1 3D model Open · Scan
TFS_sp_Q9HAH1_ZN556_HUMAN:147:408_5v3m_C_1 ModCRE Homology model CCACCCCCTCGGGGGGGCCCCCTTA Region 147-408 · 1 3D model Open · Scan
TFS_sp_Q9HAH1_ZN556_HUMAN:152:225_1a1g_A_1 ModCRE Homology model GCCCCCCCCT Region 152-225 · 1 3D model Open · Scan
TFS_sp_Q9HAH1_ZN556_HUMAN:171:313_6ml7_A_1 ModCRE Homology model AAGCTAGGGTGAGTAGCCG Region 171-313 · 1 3D model Open · Scan
TFS_sp_Q9HAH1_ZN556_HUMAN:184:337_2i13_A_1 ModCRE Homology model ACTCAGCTACTTCTCCTTCAT Region 184-337 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 456 aa
143-408

Region 143-408 9 PWM

Residues
266 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF13894 · C2H2-type zinc finger PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
10 active PDBs · 6 summary rows
Templates
1A1G, 1LLM, 2I13, 5EGB, 5EH2, 5EI9, 5V3J, 5V3M, ...
Sources
Predicted = Low
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
10 active PDB models 6 summary rows
Region 143-40810 models · 6 summary rows
Actions
Predicted = Low DIMER_sp_Q9HAH1_ZN556_HUMAN:173:221_1llm_D_1 1llm 173-221 View model · PDB
Predicted = Low TFS_sp_Q9HAH1_ZN556_HUMAN:143:405_5wjq_D_1 5wjq 143-405 View model · PDB
Predicted = Low TFS_sp_Q9HAH1_ZN556_HUMAN:147:253_5egb_A_1 5egb 147-253 View model · PDB
Predicted = Low TFS_sp_Q9HAH1_ZN556_HUMAN:147:253_5eh2_F_1 5eh2 147-253 View model · PDB
Predicted = Low TFS_sp_Q9HAH1_ZN556_HUMAN:147:253_5ei9_E_1 5ei9 147-253 View model · PDB
Predicted = Low TFS_sp_Q9HAH1_ZN556_HUMAN:147:408_5v3j_E_1 5v3j 147-408 View model · PDB
Predicted = Low TFS_sp_Q9HAH1_ZN556_HUMAN:147:408_5v3m_C_1 5v3m 147-408 View model · PDB
Predicted = Low TFS_sp_Q9HAH1_ZN556_HUMAN:152:225_1a1g_A_1 1a1g 152-225 View model · PDB
Predicted = Low TFS_sp_Q9HAH1_ZN556_HUMAN:171:313_6ml7_A_1 6ml7 171-313 View model · PDB
Predicted = Low TFS_sp_Q9HAH1_ZN556_HUMAN:184:337_2i13_A_1 2i13 184-337 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
4 2i13 143:408 184 337 P:A · DNA:C,D 48.1% / 60.4% 100 View · PDB TFS_sp_Q9HAH1_ZN556_HUMAN:184:337_2i13_A_1
1 1llm 143:408 173,173 221,221 P:C,D · DNA:A,B 46.9% / 65.3% 56,57 View · PDB DIMER_sp_Q9HAH1_ZN556_HUMAN:173:221_1llm_D_1
1 5wjq 143:408 143 405 P:D · DNA:A,B 41.3% / 58.3% 93 View · PDB TFS_sp_Q9HAH1_ZN556_HUMAN:143:405_5wjq_D_1
2 5v3m 143:408 147 408 P:C · DNA:A,B 41.1% / 55.9% 94 View · PDB TFS_sp_Q9HAH1_ZN556_HUMAN:147:408_5v3m_C_1
3 5v3j 143:408 147 408 P:E · DNA:A,B 41.1% / 55.9% 94 View · PDB TFS_sp_Q9HAH1_ZN556_HUMAN:147:408_5v3j_E_1
5 6ml7 143:408 171 313 P:A · DNA:E,F 38.5% / 58.0% 100 View · PDB TFS_sp_Q9HAH1_ZN556_HUMAN:171:313_6ml7_A_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
4-44PF01352KRAB boxNo overlap with loaded model regions
147-169PF00096Zinc finger, C2H2 typeoverlaps 143-408
175-197PF00096Zinc finger, C2H2 typeoverlaps 143-408
203-225PF00096Zinc finger, C2H2 typeoverlaps 143-408
231-253PF13894C2H2-type zinc fingeroverlaps 143-408
259-281PF00096Zinc finger, C2H2 typeoverlaps 143-408
287-309PF00096Zinc finger, C2H2 typeoverlaps 143-408
315-337PF00096Zinc finger, C2H2 typeoverlaps 143-408