ModCRE DB

Transcription factor

Q9HAJ7 - SAP30L

Histone deacetylase complex subunit SAP30L (HCV non-structural protein 4A-transactivated protein 2) (Sin3 corepressor complex subunit SAP30L) (Sin3-associated protein p30-like)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 183 aa

6 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE6
MotifPredictionSourceDNA bindingSupportLogoActions
q9haj7.af3.0 ModCRE AlphaFold3 model TAAAACCTGGACGTAAA AlphaFold3 model · ModCRE PWM Open · Scan
q9haj7.af3.1 ModCRE AlphaFold3 model AATCCCACGCAATTT AlphaFold3 model · ModCRE PWM Open · Scan
q9haj7.af3.2 ModCRE AlphaFold3 model AAATTTCCCGGTTTTTTG AlphaFold3 model · ModCRE PWM Open · Scan
q9haj7.af3.3 ModCRE AlphaFold3 model AGAAGTAATGTGCAAAA AlphaFold3 model · ModCRE PWM Open · Scan
q9haj7.af3.4 ModCRE AlphaFold3 model TAAAACCTGGACGTAAA AlphaFold3 model · ModCRE PWM Open · Scan
q9haj7.af3.5 ModCRE AlphaFold3 model GCCCTACCATGACAAAATTTT AlphaFold3 model · ModCRE PWM Open · Scan
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models
SourceModelTemplateResidues modeledActions
Predicted = Lowq9haj7.af3.0-Full sequenceView model · PDB
Predicted = Lowq9haj7.af3.1-Full sequenceView model · PDB
Predicted = Lowq9haj7.af3.2-Full sequenceView model · PDB
Predicted = Lowq9haj7.af3.3-Full sequenceView model · PDB
Predicted = Lowq9haj7.af3.4-Full sequenceView model · PDB
Predicted = Lowq9haj7.af3.5-Full sequenceView model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomain
26-95PF13866SAP30 zinc-finger
114-166PF13867Sin3 binding region of histone deacetylase complex subunit SAP30