Transcription factor

Q9HAK2 - EBF2

Transcription factor COE2 (Early B-cell factor 2) (EBF-2)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 575 aa

5 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)5

Motif	Prediction	Source	DNA binding	Support	Actions
MA1604.1	NN 70+%	JASPAR	TTCCCAAGGGACT	99.4% identity	Open · Scan
MA1637.1	NN 70+%	JASPAR	TTCCCAAGGGAAT	80.8% identity	Open · Scan
M10469_2.00	NN 70+%	CisBP	ACAAACTCCCTGGGGAATAGTG	77.8% identity	Open · Scan
MA0154.1	NN 70+%	JASPAR	ACCCAAGGGA	76.8% identity	Open · Scan
M09044_2.00	NN 70+%	CisBP	GGTCCCTGGGGACTT	72.8% identity	Open · Scan

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 575 aa

340-380

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 340-3801 model

				Actions
Predicted = Low	TFS_Q9HAK2:340:380_2ypa_A_1	2ypa	340-380	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
17-246	PF16422	Transcription factor COE1 DNA-binding domain	No overlap with loaded model regions
253-333	PF01833	IPT/TIG domain	No overlap with loaded model regions
338-381	PF16423	Transcription factor COE1 helix-loop-helix domain	overlaps 340-380