ModCRE DB

Transcription factor

Q9HBU2 - LHX3

Lim-homeobox transcription factor LHX3

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 397 aa

14 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)2
MotifPredictionSourceDNA bindingSupportLogoActions
M09137_2.00 NN 70+% CisBP ATTAATTAATTTT 81.1% identity Open · Scan
MA0135.1 NN 70+% JASPAR AAATTAATTAATC 77.7% identity Open · Scan
Nearest Neighbor (70% - 40%)12
MotifPredictionSourceDNA bindingSupportLogoActions
M03796_2.00 NN 70-40% CisBP TTAATTAA 65.7% identity Open · Scan
MA0704.1 NN 70-40% JASPAR TTAATTAA 60.2% identity Open · Scan
M05065_2.00 NN 70-40% CisBP TTAACGAG 59.4% identity Open · Scan
M06924_2.00 NN 70-40% CisBP AAACCAATAATTGAAAATTAT 55.8% identity Open · Scan
M02105_2.00 NN 70-40% CisBP TTAATTAG 52.6% identity Open · Scan
M03828_2.00 NN 70-40% CisBP GTTAATTAACGTTAATTAAC 51.8% identity Open · Scan
M09193_2.00 NN 70-40% CisBP TTTTATGGCCTT 51.6% identity Open · Scan
M01849_2.00 NN 70-40% CisBP ACTAATTAG 50.8% identity Open · Scan
M02089_2.00 NN 70-40% CisBP GTTAATTAAC 50.8% identity Open · Scan
M02111_2.00 NN 70-40% CisBP GTTAATTAG 50.0% identity Open · Scan
M02225_2.00 NN 70-40% CisBP TGTAATTT 50.0% identity Open · Scan
MA0721.1 NN 70-40% JASPAR CTAATTAA 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 397 aa
162-221

Region 162-221 0 PWM

Residues
60 aa
Domains
PF00046 · Homeodomain
3D models
1 active PDB
Templates
5HOD
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 162-2211 model
Actions
Predicted = Low DIMER_Q9HBU2:162:221_5hod_A_1 5hod 162-221 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
95-152PF00412LIM domainNo overlap with loaded model regions
163-219PF00046Homeodomainoverlaps 162-221