ModCRE DB

Transcription factor

Q9HCC6 - HES4

Transcription factor HES-4 (hHES4) (Class B basic helix-loop-helix protein 42) (bHLHb42) (Hairy and enhancer of split 4) (bHLH factor Hes4)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 221 aa

17 Generated PWM 13 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)6
MotifPredictionSourceDNA bindingSupportLogoActions
MA1099.2 NN 70-40% JASPAR GGCACGTGGC 68.2% identity Open · Scan
MA1099.1 NN 70-40% JASPAR GGCACGCGTC 63.0% identity Open · Scan
M09656_2.00 NN 70-40% CisBP GGCACGCGCC 55.7% identity Open · Scan
M05959_2.00 NN 70-40% CisBP GGCACGTGCCA 54.4% identity Open · Scan
MA0616.1 NN 70-40% JASPAR TAACGACACGTGC 50.9% identity Open · Scan
M03596_2.00 NN 70-40% CisBP TTGGCACGTGCCAT 50.0% identity Open · Scan
ModCRE11
MotifPredictionSourceDNA bindingSupportLogoActions
DIMER_sp_Q9HCC6_HES4_HUMAN:33:93_1an4_B_1 ModCRE Homology model ATTGTGCAACGCGACGCCCG Region 33-93 · 1 3D model Open · Scan
DIMER_sp_Q9HCC6_HES4_HUMAN:35:98_4atk_B_1 ModCRE Homology model GGCCAAACATGTGTCA Region 35-98 · 1 3D model Open · Scan
DIMER_sp_Q9HCC6_HES4_HUMAN:35:98_7d8t_B_1 ModCRE Homology model TGGCAAAATTTGGCA Region 35-98 · 1 3D model Open · Scan
DIMER_sp_Q9HCC6_HES4_HUMAN:41:98_4ati_A_1 ModCRE Homology model GGCCCCACATTTGGTG Region 41-98 · 1 3D model Open · Scan
DIMER_sp_Q9HCC6_HES4_HUMAN:42:88_8osl_N_1 ModCRE Homology model GATGTGCGACAGGAGCATGGCCATAGACC Region 42-88 · 1 3D model Open · Scan
TFS_sp_Q9HCC6_HES4_HUMAN:33:93_1an4_A_1 ModCRE Homology model CGGGCGTCTCGCGCGCCATT Region 33-93 · 1 3D model Open · Scan
TFS_sp_Q9HCC6_HES4_HUMAN:33:93_1an4_B_1 ModCRE Homology model CGGGCGTCACGTTGCACAAT Region 33-93 · 1 3D model Open · Scan
TFS_sp_Q9HCC6_HES4_HUMAN:35:98_4atk_B_1 ModCRE Homology model TGACACATGTTTGGCC Region 35-98 · 1 3D model Open · Scan
TFS_sp_Q9HCC6_HES4_HUMAN:35:98_7d8t_B_1 ModCRE Homology model GGCCAAATTTTGCAA Region 35-98 · 1 3D model Open · Scan
TFS_sp_Q9HCC6_HES4_HUMAN:41:98_4ati_A_1 ModCRE Homology model CACCAAATGTGTGGCA Region 41-98 · 1 3D model Open · Scan
TFS_sp_Q9HCC6_HES4_HUMAN:42:92_4h10_A_1 ModCRE Homology model TTTCCCCCTGCACC Region 42-92 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 221 aa
33-98

Region 33-98 11 PWM

Residues
66 aa
Domains
PF00010 · Helix-loop-helix DNA-binding domain
3D models
13 active PDBs · 10 summary rows
Templates
1AM9, 1AN4, 4ATI, 4ATK, 4H10, 7D8T, 8OSL
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
13 active PDB models 10 summary rows
Region 33-9813 models · 10 summary rows
Actions
Predicted = Low DIMER_sp_Q9HCC6_HES4_HUMAN:33:93_1an4_B_1 1an4 33-93 View model · PDB
Predicted = Low DIMER_sp_Q9HCC6_HES4_HUMAN:35:62_1am9_B_1 1am9 35-62 View model · PDB
Predicted = Low DIMER_sp_Q9HCC6_HES4_HUMAN:35:62_1am9_D_1 1am9 35-62 View model · PDB
Predicted = Low DIMER_sp_Q9HCC6_HES4_HUMAN:35:98_4atk_B_1 4atk 35-98 View model · PDB
Predicted = Low DIMER_sp_Q9HCC6_HES4_HUMAN:35:98_7d8t_B_1 7d8t 35-98 View model · PDB
Predicted = Low DIMER_sp_Q9HCC6_HES4_HUMAN:41:98_4ati_A_1 4ati 41-98 View model · PDB
Predicted = Low DIMER_sp_Q9HCC6_HES4_HUMAN:42:88_8osl_N_1 8osl 42-88 View model · PDB
Predicted = Low TFS_sp_Q9HCC6_HES4_HUMAN:33:93_1an4_A_1 1an4 33-93 View model · PDB
Predicted = Low TFS_sp_Q9HCC6_HES4_HUMAN:33:93_1an4_B_1 1an4 33-93 View model · PDB
Predicted = Low TFS_sp_Q9HCC6_HES4_HUMAN:35:98_4atk_B_1 4atk 35-98 View model · PDB
Predicted = Low TFS_sp_Q9HCC6_HES4_HUMAN:35:98_7d8t_B_1 7d8t 35-98 View model · PDB
Predicted = Low TFS_sp_Q9HCC6_HES4_HUMAN:41:98_4ati_A_1 4ati 41-98 View model · PDB
Predicted = Low TFS_sp_Q9HCC6_HES4_HUMAN:42:92_4h10_A_1 4h10 42-92 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
2 4ati 30:98 41,35 98,98 P:A,B · DNA:C,D 34.5% / 55.2% 87,83 View · PDB DIMER_sp_Q9HCC6_HES4_HUMAN:41:98_4ati_A_1
2 4ati 30:98 41,35 98,98 P:A,B · DNA:C,D 34.5% / 55.2% 87,83 View · PDB TFS_sp_Q9HCC6_HES4_HUMAN:41:98_4ati_A_1
3 4h10 30:98 42 92 P:A · DNA:C,D 33.3% / 62.7% 78 View · PDB TFS_sp_Q9HCC6_HES4_HUMAN:42:92_4h10_A_1
1 4atk 30:98 41,35 98,98 P:A,B · DNA:C,D 32.8% / 56.2% 86,100 View · PDB DIMER_sp_Q9HCC6_HES4_HUMAN:35:98_4atk_B_1
1 4atk 30:98 41,35 98,98 P:A,B · DNA:C,D 32.8% / 56.2% 86,100 View · PDB TFS_sp_Q9HCC6_HES4_HUMAN:35:98_4atk_B_1
4 7d8t 30:98 35,35 98,98 P:A,B · DNA:C,D 32.8% / 56.2% 30,30 View · PDB DIMER_sp_Q9HCC6_HES4_HUMAN:35:98_7d8t_B_1
5 7d8t 30:98 35,35 98,98 P:A,B · DNA:C,D 32.8% / 56.2% 30,30 View · PDB TFS_sp_Q9HCC6_HES4_HUMAN:35:98_7d8t_B_1
5 8osl 30:98 42,42 88,88 P:N,P · DNA:I,J 31.9% / 59.6% 14,86 View · PDB DIMER_sp_Q9HCC6_HES4_HUMAN:42:88_8osl_N_1
3 1an4 30:98 33,33 93,93 P:A,B · DNA:C,D 31.1% / 52.5% 90,90 View · PDB DIMER_sp_Q9HCC6_HES4_HUMAN:33:93_1an4_B_1
4 1an4 30:98 33,33 93,93 P:A,B · DNA:C,D 31.1% / 52.5% 90,90 View · PDB TFS_sp_Q9HCC6_HES4_HUMAN:33:93_1an4_B_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
35-92PF00010Helix-loop-helix DNA-binding domainoverlaps 33-98
109-148PF07527Hairy OrangeNo overlap with loaded model regions