ModCRE DB

Transcription factor

Q9HCX3 - ZNF304

Zinc finger protein 304 (KRAB-containing zinc finger protein)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 659 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1
MotifPredictionSourceDNA bindingSupportLogoActions
M07587_2.00 Known CisBP CCCCCTCCCCAGTCGAGCCCCCGC Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 659 aa
278-439

Region 278-439 0 PWM

Residues
162 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5T0U
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 278-4391 model
Actions
Predicted = Low TFS_Q9HCX3:278:439_5t0u_A_1 5t0u 278-439 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
13-54PF01352KRAB boxNo overlap with loaded model regions
279-301PF00096Zinc finger, C2H2 typeoverlaps 278-439
307-329PF00096Zinc finger, C2H2 typeoverlaps 278-439
335-357PF00096Zinc finger, C2H2 typeoverlaps 278-439
363-385PF00096Zinc finger, C2H2 typeoverlaps 278-439
391-413PF00096Zinc finger, C2H2 typeoverlaps 278-439
419-441PF00096Zinc finger, C2H2 typeoverlaps 278-439
475-497PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
503-525PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
531-553PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
559-581PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
587-609PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
615-637PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions