Transcription factor

Q9HD72

Krueppel-related zinc finger protein SBZF5

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 424 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
M08864_2.00	Known	CisBP	CCTCCCCCCCCGCCCCCTCCCC	Direct PWM		Open · Scan

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 424 aa

353-423

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 353-4231 model

				Actions
Predicted = Low	TFS_Q9HD72:353:423_5egb_A_1	5egb	353-423	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
30-73	PF00651	BTB/POZ domain	No overlap with loaded model regions
102-159	PF00651	BTB/POZ domain	No overlap with loaded model regions
293-314	PF00096	Zinc finger, C2H2 type	No overlap with loaded model regions
357-377	PF00096	Zinc finger, C2H2 type	overlaps 353-423
383-405	PF13894	C2H2-type zinc finger	overlaps 353-423